ID: 964417166

View in Genome Browser
Species Human (GRCh38)
Location 3:156459509-156459531
Sequence CAAGCTGGACATTTATATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964417163_964417166 -9 Left 964417163 3:156459495-156459517 CCTTTGGACACTACCAAGCTGGA 0: 1
1: 0
2: 0
3: 9
4: 71
Right 964417166 3:156459509-156459531 CAAGCTGGACATTTATATATGGG 0: 1
1: 0
2: 1
3: 9
4: 144
964417161_964417166 -8 Left 964417161 3:156459494-156459516 CCCTTTGGACACTACCAAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 102
Right 964417166 3:156459509-156459531 CAAGCTGGACATTTATATATGGG 0: 1
1: 0
2: 1
3: 9
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964417166 Original CRISPR CAAGCTGGACATTTATATAT GGG Intronic
901372529 1:8811863-8811885 CAGCCTGGACATTCATATACAGG + Intronic
906461482 1:46037790-46037812 GAAGCTGGACATCTAGATTTGGG + Intergenic
906548654 1:46641927-46641949 CAGGCTGGAGATATAAATATGGG - Intronic
907410004 1:54277133-54277155 CAAGCTTCTCATTTATAGATGGG - Intronic
909155700 1:72072998-72073020 CAAGATAGAGATTTGTATATAGG + Intronic
911269467 1:95782694-95782716 CAAGATAGACAGTTAAATATAGG - Intergenic
912780175 1:112539131-112539153 CAAGCTTTAAATGTATATATAGG + Intronic
917756457 1:178104273-178104295 CAAGATTGCCATTTATATTTTGG + Intronic
917763663 1:178193656-178193678 CAAACAGGACATTTAAATCTAGG - Intronic
921596724 1:217062337-217062359 AAAGCTGGAAATTTCTCTATTGG + Intronic
923966891 1:239151636-239151658 GAAGCTGGAAATATATATTTGGG + Intergenic
1067974163 10:51005482-51005504 TAAGCTGGACATTTGTAAATTGG + Intronic
1069315250 10:67091097-67091119 GAAGCTTGACCTTTATATACAGG - Intronic
1069499550 10:68939019-68939041 AAAGCTTGACTTTTATATTTAGG + Intronic
1071062242 10:81585873-81585895 CAACCTGCACATTTAGAGATTGG + Intergenic
1071924364 10:90388804-90388826 CAAGCTAGACATTGAAAAATAGG + Intergenic
1072279823 10:93855649-93855671 CATATTTGACATTTATATATAGG + Intergenic
1073743387 10:106437394-106437416 AAAGCTGCACATTTATTAATAGG + Intergenic
1074552581 10:114458529-114458551 CAAGATGTTCATTTATATTTGGG - Intronic
1075537010 10:123279733-123279755 CAAGTTGGGCATTTTTACATAGG - Intergenic
1080236499 11:30074826-30074848 CAAGTTGGACAGTTATACACAGG + Intergenic
1081236531 11:40653920-40653942 CCAGCTGAACATTTTTAAATTGG + Intronic
1081258754 11:40931738-40931760 GAATCATGACATTTATATATAGG - Intronic
1085440259 11:76555407-76555429 CAAGCTGGACTTTGACAAATGGG - Intergenic
1085959389 11:81442754-81442776 TAATCTGGGGATTTATATATTGG - Intergenic
1087445883 11:98252948-98252970 CAAACTGTACAATTGTATATAGG - Intergenic
1089993267 11:122881769-122881791 TAAGCTGTACATTTATGTATGGG - Intergenic
1090447771 11:126778814-126778836 CATGCTGGACTTATATAAATGGG - Intronic
1091136340 11:133194027-133194049 AAATGTGGACATTTATATCTAGG - Intronic
1091922475 12:4316591-4316613 GAACCTGGAAATATATATATAGG + Intergenic
1092032263 12:5297068-5297090 GAAGCTGGAAAGTTATATAGGGG - Intergenic
1095129784 12:38526687-38526709 AAAGATACACATTTATATATCGG - Intergenic
1100191231 12:92194142-92194164 AAAACTGGCCATTAATATATAGG + Intergenic
1100837695 12:98582677-98582699 CAATCTGTATATCTATATATGGG + Intergenic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1104345481 12:127992823-127992845 CAACCTTGGCAATTATATATTGG + Intergenic
1108807245 13:54173766-54173788 CAAGCTGAACATTAATGTCTTGG + Intergenic
1109017334 13:57034298-57034320 CAAAATGTACATTTATAAATTGG + Intergenic
1111172639 13:84548388-84548410 CAGGCTAGACATATATATACAGG + Intergenic
1111225026 13:85258834-85258856 CATATTGGACATTGATATATTGG - Intergenic
1112049547 13:95632196-95632218 CAGGCTGGAGATTTAAATCTGGG - Intronic
1112319306 13:98392565-98392587 CAAGATGCAGAATTATATATGGG - Intronic
1116624872 14:47251539-47251561 CATCCTGAACATTGATATATGGG + Intronic
1117845502 14:59907303-59907325 CAGGCTGGAAATATATATTTAGG - Intergenic
1124909102 15:33900721-33900743 AAAACTTGACATTTATCTATAGG + Intronic
1125754715 15:42055660-42055682 CAATCTGGACATTTTAATTTAGG - Intergenic
1127220330 15:56873706-56873728 CAAGCTGGAGATATAGATTTGGG + Intronic
1128446919 15:67770753-67770775 AAAGCTTGACATTTATATTAAGG - Intronic
1131197625 15:90368451-90368473 CAAGTTGGTAATTTACATATCGG + Intronic
1137055660 16:35745700-35745722 CCATCTGGACATTTATGTGTAGG + Intergenic
1144487590 17:15679969-15679991 CAAGCTTGAGAATTATATCTAGG + Intronic
1144913443 17:18702328-18702350 CAAGCTTGAGAATTATATCTAGG - Intronic
1145039692 17:19568080-19568102 AAACCTGGACATTTATCTTTGGG + Intronic
1145116473 17:20214905-20214927 CAAGCTGGAGATCTATGAATAGG - Intronic
1156942304 18:42783271-42783293 TAAGCTGGTCATTGATATGTGGG + Intronic
1157183940 18:45522323-45522345 CAAGCTGGACATTTTCTCATGGG - Intronic
1159033597 18:63256178-63256200 CAAGCTGGTAAAATATATATGGG + Intronic
1164125088 19:22307101-22307123 AAAGCTATATATTTATATATGGG + Intronic
928216292 2:29364217-29364239 CAAGCTGGGCATTTATTTTCTGG - Intronic
928349924 2:30540987-30541009 GAGGCTGGACATTTTTCTATTGG + Intronic
928444261 2:31319031-31319053 CATGCTGGACTTTTATATACGGG + Intergenic
928471940 2:31583483-31583505 CAAGCTGTATATTTATAATTGGG - Intergenic
929300145 2:40294530-40294552 CAAGTTGCATATATATATATGGG + Intronic
930291600 2:49500822-49500844 CCATCTGTACATTTTTATATAGG + Intergenic
931554654 2:63489075-63489097 TAAGGAGGACATTTACATATGGG + Intronic
931649757 2:64456689-64456711 CAATTTGGACATGTAAATATGGG - Intronic
934139937 2:89036552-89036574 CAAGCTTGCCATTTATTCATGGG + Intergenic
934145986 2:89094316-89094338 CAAGCTTGTCATTTGTTTATGGG + Intergenic
934223272 2:90106252-90106274 CAAGCTTGTCATTTGTTTATGGG - Intergenic
934229303 2:90163999-90164021 CAAGCTTGCCATTTATTCATGGG - Intergenic
935263274 2:101373375-101373397 TATTCTGGACATTAATATATGGG - Intronic
937147968 2:119663599-119663621 GAAGCTGGACAGTTATAAAATGG + Intergenic
940455709 2:153896825-153896847 TAATCTAGACATTTATATTTAGG - Intronic
943585964 2:189740527-189740549 CTAGCTGCACATTTAATTATTGG + Intronic
1174643818 20:52068230-52068252 CAAGATTTACATTTAAATATAGG + Intronic
1177444643 21:21176960-21176982 CAGGCTAGACATTTATATTTAGG - Intronic
1177921234 21:27155061-27155083 CAAGTTGGACATTTATCTGGAGG - Intergenic
1178114082 21:29399112-29399134 CAGGCTGGAGATATACATATAGG - Intronic
1183011984 22:34954309-34954331 GAAGCTGGAAAATTAAATATTGG - Intergenic
1184524421 22:45013381-45013403 CAAGCTGCACAGCTATAAATGGG + Intergenic
1185093188 22:48787440-48787462 CAAGCTGTACATCTAAATACGGG - Intronic
952142039 3:30490701-30490723 CAACCTGGTCATTTAGACATGGG + Intergenic
952625835 3:35402191-35402213 CACTCTGGGGATTTATATATAGG + Intergenic
952675419 3:36024341-36024363 CATGCTGTACAGTTTTATATAGG + Intergenic
954720797 3:52560981-52561003 CCATCTGGAATTTTATATATTGG - Intronic
955438214 3:58927232-58927254 CAAAATGAATATTTATATATGGG - Intronic
958088451 3:88843967-88843989 CAAGATGGAACTTTATATACTGG + Intergenic
958847011 3:99277381-99277403 CAAGCTGGGCACTTATTTAGAGG - Intergenic
963155477 3:142091586-142091608 TAAGCTAGACATTTTTATATTGG + Intronic
964168559 3:153738702-153738724 CAAGCTGCACATCCATATTTGGG - Intergenic
964417166 3:156459509-156459531 CAAGCTGGACATTTATATATGGG + Intronic
966421348 3:179737663-179737685 TAAGCTGGTCATTTATATACAGG + Intronic
970254970 4:14158256-14158278 CCAGCTTAACATTTACATATGGG - Intergenic
970262264 4:14239516-14239538 CAAGCTGGAAAAAAATATATGGG + Intergenic
971456708 4:26851990-26852012 CAAGCTGGAGATTTAGATTTAGG - Intergenic
972673072 4:41232490-41232512 CCAGCTGGAGATATAAATATGGG + Intergenic
977330760 4:95634524-95634546 ATAGCTTGATATTTATATATGGG + Intergenic
977573646 4:98655849-98655871 AAAGCAGGAAATTTAAATATGGG + Intronic
978424923 4:108572183-108572205 GAAGCTGGGCTTTTGTATATGGG - Intergenic
979491511 4:121333636-121333658 CAATCTGAATATTTGTATATTGG - Intronic
979756141 4:124341706-124341728 CAAGCAGGACAGGCATATATGGG + Intergenic
980535055 4:134108845-134108867 TAAGGAGGACATTTTTATATAGG + Intergenic
981864101 4:149393724-149393746 TAAGCTGGACATTTAATTCTTGG - Intergenic
982770656 4:159393827-159393849 CAAGTTGGAATTTTAAATATAGG - Intergenic
985001151 4:185484708-185484730 CAAACTGACCATTGATATATGGG + Intergenic
987007240 5:13723157-13723179 CAAGTTAGAGATTTAGATATTGG - Intronic
987470424 5:18321158-18321180 CACGCTCTGCATTTATATATAGG - Intergenic
987982876 5:25110867-25110889 CTAGCTGGAGATTTATTTTTTGG - Intergenic
988212648 5:28225910-28225932 CAACCAGGACATTCATATATTGG + Intergenic
988691297 5:33575545-33575567 GAAGCTAAAAATTTATATATAGG - Intronic
992380256 5:76229354-76229376 CAGGCTGGACAATTAGAAATGGG + Intronic
993446334 5:88016424-88016446 GAAGCTGGACATATATTTTTTGG + Intergenic
994813172 5:104548708-104548730 CAAACAGGCCATTTCTATATTGG + Intergenic
994893589 5:105671225-105671247 CAAAGTGGACTTTTATTTATGGG + Intergenic
995341865 5:111069972-111069994 GCAGCTGGACATTATTATATAGG - Intergenic
998814345 5:145997371-145997393 CAGCCTGGTCATTTATAAATGGG + Intronic
999689052 5:154129644-154129666 GAATCTGAACATTTATATTTTGG + Intronic
1000531754 5:162430590-162430612 CATGCTGGTCAGTTATATGTGGG - Intergenic
1005372589 6:25151122-25151144 CAAAGTGAACATTTATATACAGG - Intergenic
1007013512 6:38440113-38440135 CAAGCTGGATATATAGATTTGGG + Intronic
1009614052 6:65982445-65982467 GAAGGAGGTCATTTATATATTGG - Intergenic
1012913871 6:105147296-105147318 CATGCTTGAGATTTATAGATGGG - Intergenic
1016274582 6:142334121-142334143 CAAGTTGAACATTCATATCTTGG - Intronic
1016775294 6:147898187-147898209 CACGCTGTAAATTTATAAATCGG - Intergenic
1019763082 7:2828752-2828774 CAAGCAGGCCATTTTCATATGGG - Intronic
1023235840 7:38085749-38085771 TAAGCCAGACATTAATATATGGG + Intergenic
1027830682 7:83173376-83173398 AAAGCTAGATATTAATATATTGG + Intergenic
1028471142 7:91207750-91207772 ATAACTGCACATTTATATATAGG + Exonic
1029183083 7:98718939-98718961 CAAGCTGGCTGTATATATATTGG - Intergenic
1030930003 7:115511025-115511047 CTAGCTGAATATTTATATTTTGG - Intergenic
1031692124 7:124801830-124801852 GAAACTTGACATTTATAAATGGG + Intergenic
1031944468 7:127825008-127825030 CCAGCTGGAGAATTATATGTAGG + Intronic
1033809533 7:144995010-144995032 CATGCTGCACATTTATAATTTGG + Intergenic
1037206652 8:16329716-16329738 TATGCTATACATTTATATATAGG - Intronic
1037650311 8:20831462-20831484 CAAGCTGAATATATATATATTGG - Intergenic
1038712891 8:29964639-29964661 CAAGCTGGAAATTTATTTTGGGG + Intergenic
1038833997 8:31098266-31098288 CAACCATGAAATTTATATATAGG - Intronic
1039360883 8:36875605-36875627 GAAACTGGACATTTTTATTTTGG - Intronic
1041428523 8:57750972-57750994 CAAGATGTATATTTAGATATGGG - Intergenic
1042509435 8:69596154-69596176 AAAGCTAAACTTTTATATATGGG + Intronic
1043773100 8:84229500-84229522 CAAACTGGAAATTAATATTTGGG - Intronic
1044599341 8:93988271-93988293 CCAGCTGGACCTCTTTATATGGG - Intergenic
1046833858 8:118777770-118777792 CAAGCTGGTCACTTATATATGGG - Intergenic
1049036175 8:140077882-140077904 CATGCTGGACTTTTCTATCTGGG - Intronic
1055958551 9:81797318-81797340 AAAGATGGAGATCTATATATAGG - Intergenic
1059911425 9:119048579-119048601 CAAGCTGGACAGTTAGAAAGTGG - Intergenic
1060004142 9:119984655-119984677 CAAGCTGGAGATGTCTGTATAGG - Intergenic
1188258761 X:27997125-27997147 CAAGCTGCTCATTTATAAAGTGG + Intergenic
1189000771 X:36942124-36942146 GAAACTGCACATTTATAGATGGG - Intergenic
1189106269 X:38238872-38238894 GAAGCTGGACCTTTATGTACTGG + Intronic
1191635062 X:63367417-63367439 CAACCTGCACATTTATTAATTGG - Intergenic
1191930205 X:66364462-66364484 CAATCTGGACATTCTTCTATAGG + Intergenic
1197331869 X:125162769-125162791 CAAGCTGCAGATGTAGATATGGG - Intergenic
1198417042 X:136430826-136430848 CAAGCTGGAGATATAAATTTGGG + Intergenic
1198624739 X:138558275-138558297 CATGCTGTACATGTATATGTAGG - Intergenic