ID: 964417274

View in Genome Browser
Species Human (GRCh38)
Location 3:156460562-156460584
Sequence GCTTAATTCTGTACTCGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 53}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964417274_964417278 9 Left 964417274 3:156460562-156460584 CCAGCACGAGTACAGAATTAAGC 0: 1
1: 0
2: 1
3: 6
4: 53
Right 964417278 3:156460594-156460616 CAAAGGTTACTGAACAAGTTTGG 0: 1
1: 0
2: 0
3: 11
4: 146
964417274_964417275 -8 Left 964417274 3:156460562-156460584 CCAGCACGAGTACAGAATTAAGC 0: 1
1: 0
2: 1
3: 6
4: 53
Right 964417275 3:156460577-156460599 AATTAAGCAAAGCCCAGCAAAGG 0: 1
1: 0
2: 0
3: 22
4: 223
964417274_964417281 27 Left 964417274 3:156460562-156460584 CCAGCACGAGTACAGAATTAAGC 0: 1
1: 0
2: 1
3: 6
4: 53
Right 964417281 3:156460612-156460634 TTTGGGGTCCTCCTCTGCCCTGG 0: 1
1: 0
2: 0
3: 26
4: 372
964417274_964417280 11 Left 964417274 3:156460562-156460584 CCAGCACGAGTACAGAATTAAGC 0: 1
1: 0
2: 1
3: 6
4: 53
Right 964417280 3:156460596-156460618 AAGGTTACTGAACAAGTTTGGGG 0: 1
1: 0
2: 1
3: 11
4: 192
964417274_964417279 10 Left 964417274 3:156460562-156460584 CCAGCACGAGTACAGAATTAAGC 0: 1
1: 0
2: 1
3: 6
4: 53
Right 964417279 3:156460595-156460617 AAAGGTTACTGAACAAGTTTGGG 0: 1
1: 0
2: 1
3: 15
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964417274 Original CRISPR GCTTAATTCTGTACTCGTGC TGG (reversed) Intronic
916506078 1:165429165-165429187 GCTTATTTCTGTCCTAGAGCAGG - Intronic
918704914 1:187647770-187647792 GTTTAATTCTGTACTCCTTCAGG - Intergenic
923647902 1:235842869-235842891 GCTTAATTCTGTAATCTTTTAGG - Intronic
1062823507 10:551725-551747 GCTGAATTCTGTACCTGTGTGGG - Intronic
1065088519 10:22205057-22205079 GCTTCATTCTCTGCTTGTGCTGG - Intergenic
1065330583 10:24593347-24593369 TCTTAAATCTGTGCTGGTGCTGG + Intronic
1065542789 10:26786560-26786582 GCTAAAATTTGTACTAGTGCTGG - Intronic
1071491169 10:86137517-86137539 GCTGGATTCTGTACTGGTGATGG - Intronic
1078326788 11:10387745-10387767 GCTGAATTCTGGGCTCATGCAGG + Intronic
1085302946 11:75468957-75468979 GCTTACATCTGTAATCGTGCTGG - Intronic
1087746354 11:101951976-101951998 GCTTAATTCAGTACTCATGTTGG + Intronic
1089631463 11:119787149-119787171 CCTTCATCCTGTGCTCGTGCAGG + Intergenic
1090468820 11:126959943-126959965 GCTGGATTCTGTACTCCTTCTGG + Intronic
1092325428 12:7526877-7526899 GCCCAGTTCTGTACTCTTGCTGG + Intergenic
1093714625 12:22367048-22367070 GCTTTGTTCTGTTCTCTTGCTGG - Intronic
1095512220 12:42964811-42964833 GGTTACTTTTGTACTCTTGCAGG - Intergenic
1098685925 12:73420992-73421014 GTTTAATTCTATACTAGTGGAGG + Intergenic
1102741771 12:115213808-115213830 GCTTCAATCTGTACTCTTCCAGG + Intergenic
1115343206 14:32314536-32314558 GCTAAATTCTGTGCTCCTGCTGG + Intergenic
1117847477 14:59926396-59926418 GCTAAATTATGTACATGTGCTGG - Intronic
1131151511 15:90050175-90050197 GCATAAATCCGTACTCGAGCTGG + Intronic
1146131082 17:30275730-30275752 TCTTTATTCTGTCCTTGTGCAGG - Intronic
1146758926 17:35458786-35458808 GCTCAGTTCTGTGCTCTTGCTGG + Intergenic
1153084282 18:1265822-1265844 GCTTAATGCTGTACTGGTGAAGG - Intergenic
1155046322 18:22106438-22106460 GGTTTATTCTGTACCCATGCTGG - Intergenic
1155842231 18:30659800-30659822 GCTTACTTCTGTACTCTTGCTGG - Intergenic
926987270 2:18638799-18638821 GCCCAGTTCTGTACTCTTGCTGG + Intergenic
926999882 2:18783587-18783609 GCTTATGTCTGTCCTAGTGCTGG + Intergenic
932078679 2:68691131-68691153 GCTTATTGGTGTACTCCTGCTGG - Intronic
936750315 2:115634225-115634247 GCCTAGTTCTGTGCTCTTGCTGG + Intronic
943016324 2:182515046-182515068 TCTTAATTCTGAACTTGGGCAGG + Intronic
946942349 2:224782958-224782980 CCTTCATTCTGTACACGTTCGGG + Intronic
1177956460 21:27605423-27605445 GCCTAATTCTGCACCCTTGCTGG + Intergenic
949938175 3:9133672-9133694 GCTTCATTCTGCACATGTGCAGG + Intronic
952679300 3:36073299-36073321 GCTCAGTTCTGTGCTCTTGCTGG + Intergenic
957650756 3:82999790-82999812 GCTTAATTCTTTTCTCATGGGGG - Intergenic
964417274 3:156460562-156460584 GCTTAATTCTGTACTCGTGCTGG - Intronic
971306194 4:25483649-25483671 GTTTAACTCTGTACACTTGCAGG + Intergenic
973530615 4:51833819-51833841 GCAAAATTCTGTTCTAGTGCTGG + Intergenic
976149601 4:82078709-82078731 GTTTAAGTCTTTACTCCTGCTGG - Intergenic
990799289 5:59582045-59582067 GCTTAATTCTGAATTCCTGTTGG - Intronic
992147918 5:73870716-73870738 GCTGAATTCTGTACTCAGGATGG - Intronic
996054724 5:118969799-118969821 GCCTAGTTCTGTACCCATGCTGG - Intronic
998527081 5:142852367-142852389 GCTGAGTTCTTTACTAGTGCTGG + Intronic
1034559204 7:151869221-151869243 TGTTAATTCAGTACTCGAGCTGG + Intronic
1035538393 8:410896-410918 GCTTAATTCTTGACTGGTGTAGG - Intronic
1037080415 8:14778259-14778281 CCTTAATTCTGTACTCCTGAAGG - Intronic
1037303103 8:17473872-17473894 GCTTAATTCTGTAATCTGACTGG - Intergenic
1046657578 8:116912390-116912412 GCCCAATTCTGTGCTCTTGCTGG + Intergenic
1048429191 8:134353269-134353291 GCCCAATTCTGTGCTCTTGCTGG + Intergenic
1050847121 9:10235552-10235574 GCCTATTTCTGGACTCCTGCAGG + Intronic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1059353403 9:113681930-113681952 GCTCAATTCTGAGCTCGTGAAGG - Intergenic
1062479287 9:136744031-136744053 GCTTTATTCTGAGCTGGTGCTGG + Exonic
1185838015 X:3363066-3363088 GCTGAATTCTTTACTCAGGCAGG + Intergenic
1186818396 X:13260721-13260743 GCTTAATTCGGTGCTCCTGAAGG + Intergenic
1188384303 X:29537176-29537198 TCTTTATTCTGTACTCGCACAGG - Intronic
1188868104 X:35339814-35339836 TCTTATTTCTGTACTCTTTCGGG - Intergenic
1193899849 X:87163812-87163834 GCTTAGTTCTGTTCTCCTGTTGG + Intergenic
1194202175 X:90965972-90965994 GCTACATACTGTACTAGTGCTGG + Intergenic
1200548012 Y:4541426-4541448 GCTACATACTGTACTAGTGCTGG + Intergenic