ID: 964418391

View in Genome Browser
Species Human (GRCh38)
Location 3:156473991-156474013
Sequence ATGTTTCAGCCCTAACCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964418391 Original CRISPR ATGTTTCAGCCCTAACCATT TGG (reversed) Intronic
905808918 1:40897750-40897772 ATCTTTCAGCCCTAACATTCTGG - Intergenic
908919706 1:69174626-69174648 ATCTTTCAGCTGTAACAATTTGG - Intergenic
909817993 1:80020908-80020930 TTGTTTCAGCTTTATCCATTGGG + Intergenic
912416827 1:109514464-109514486 ATATTTTAGCCCTCACCACTAGG + Intergenic
913120403 1:115734890-115734912 ATGTTTCATCCCCAACAAATTGG - Intronic
917241557 1:172954377-172954399 ATGTTTCAATCCCAACCATGAGG - Intergenic
917451036 1:175147482-175147504 TTGTCTCAGCCCTAACCCCTGGG - Exonic
919369355 1:196704558-196704580 ATGTTTCCGGACTAACCTTTTGG - Intronic
924800509 1:247326673-247326695 ATGTTGAAGCCCTAACCCTTAGG + Intronic
1065618515 10:27554004-27554026 ATATGTAAGCCATAACCATTGGG - Intergenic
1066770547 10:38841864-38841886 TTGTTCCAGTCCTATCCATTCGG - Intergenic
1068950605 10:62773156-62773178 ATGTTACATCACTAATCATTAGG - Intergenic
1069186662 10:65431059-65431081 AAGATTCAGACCTAAGCATTTGG + Intergenic
1070468879 10:76757126-76757148 ATGTTCCAGCCTTGGCCATTGGG - Intergenic
1073169046 10:101486311-101486333 ATGCTCCAGCCCCCACCATTCGG - Intronic
1074405043 10:113174057-113174079 ATGTTTCTGCCGTAACTATAGGG - Intergenic
1086472940 11:87135605-87135627 ATGTTTAAACCCAAACCATGCGG + Intronic
1087996844 11:104819571-104819593 ATGTTTCAGGACTAATCATTGGG - Intergenic
1088790299 11:113219584-113219606 ATATCTCGGCCCTAACAATTTGG - Intronic
1088895056 11:114072225-114072247 ATGTCTCAGCCCCAAACATGAGG - Intronic
1091084240 11:132705225-132705247 ATGTTTCAGCCCCATCCCCTTGG + Intronic
1092983242 12:13819006-13819028 ATGTTGAAGGCCTAACCACTAGG + Intronic
1094067309 12:26375139-26375161 ATGTATCAGTCCTAACAATGTGG + Intronic
1098990075 12:77056235-77056257 ACTTTTCAGCCCTAAACATATGG - Intronic
1101255992 12:102977317-102977339 GTGTTTCTGCCCTAGGCATTGGG - Intergenic
1102193570 12:111007893-111007915 ATGTTGAAGCCCTAACCTTGAGG - Intergenic
1105203490 13:18199566-18199588 ATGTTTCAGCCATAAAGCTTTGG - Intergenic
1108020038 13:46118738-46118760 TTGTTTTAGCTCTTACCATTGGG - Intergenic
1108251253 13:48570278-48570300 ATGTGACAGCCCTAACAGTTGGG + Intergenic
1108269737 13:48748094-48748116 ACTTTTCAGACCTAACCCTTTGG - Intergenic
1110009212 13:70310458-70310480 CTGTTTGAGCACTAACCATATGG + Intergenic
1110364934 13:74672006-74672028 ATATTTCAGCCCCAACAATTTGG - Intergenic
1114066728 14:19066269-19066291 ATGTTTCAGCCAGAAACCTTTGG - Intergenic
1114095538 14:19333758-19333780 ATGTTTCAGCCAGAAACCTTTGG + Intergenic
1115527273 14:34293812-34293834 ATGTTGCAGCCAGAAGCATTGGG - Intronic
1119750563 14:77074665-77074687 ATGTTGCAGCCCTAACCCCCAGG - Intergenic
1121213046 14:92223528-92223550 ATGTTACATCACTAACCATGTGG - Intergenic
1124051259 15:26199217-26199239 ATGTTGCAGCCCCAGCCCTTGGG + Intergenic
1124685315 15:31777391-31777413 ATGGTTCAGCGTTGACCATTTGG - Intronic
1125868769 15:43078153-43078175 AGGTTTCATCCCTTAGCATTGGG - Intronic
1130539427 15:84811437-84811459 ATGTTTCAGCTCTACTCATTGGG + Intergenic
1134031763 16:10997824-10997846 ATGTTTCAGCCCTATAGTTTTGG + Intronic
1138797185 16:59983008-59983030 ATGGTTTAGGCCTAACCATTTGG - Intergenic
1146108131 17:30061899-30061921 ATGTTTCTGCCCAAAAGATTAGG - Intronic
1150053255 17:61986892-61986914 ATGTTTTAGCCCTGAACAATAGG - Intronic
1150063187 17:62086350-62086372 ATGTCTAAGCCCTATGCATTGGG + Intergenic
1151398609 17:73841379-73841401 GTGTGTCAGCCCTAAGCTTTTGG - Intergenic
1152297297 17:79475512-79475534 ATGTTCCAGCCCTAACCCCCAGG + Intronic
1153202171 18:2656865-2656887 CTGTCTGAGCCCTAACCCTTGGG + Intronic
1153684286 18:7529458-7529480 TTGTTTCAGCCCTAACGCTATGG - Intergenic
1156649848 18:39212848-39212870 ATCTTTCAGCACTAAAGATTTGG - Intergenic
1157177389 18:45464057-45464079 ATGATTCTGCCCAGACCATTTGG - Intronic
1158007858 18:52693774-52693796 TTGTTTCAGCTCTGACAATTGGG - Intronic
1164781052 19:30893192-30893214 ATGTCTCAGTCCTGACCAATGGG - Intergenic
1168494793 19:56839677-56839699 CTGTTCCAGCCCCACCCATTGGG - Intronic
928508978 2:31983924-31983946 ATTTTTCAGCCTTAGCTATTGGG - Intronic
933277674 2:80301267-80301289 AGCTTTCAGCCCTAAACATCGGG + Intronic
933553902 2:83808425-83808447 ATTTTTCAGGCCTGACCATAGGG + Intergenic
938484126 2:131686363-131686385 ATGTTGCAGCCATAAACCTTTGG - Intergenic
938828306 2:135029046-135029068 ATTTTTAACCCCTAAACATTAGG - Intronic
940101950 2:150050442-150050464 ATATTTAAGCCCCAACCATCTGG + Intergenic
940702871 2:157068231-157068253 ATGATTGAGCCCTGACCTTTGGG + Intergenic
943194457 2:184726519-184726541 TGGTTTCAGCCCTATCCAATTGG - Intronic
945509028 2:210677711-210677733 ATGTCTCAGACCTCACCATGGGG - Intronic
1170095714 20:12643732-12643754 ATTTCTCAGCCCTTGCCATTAGG + Intergenic
1170569504 20:17624979-17625001 AGGGATCAGCACTAACCATTTGG - Intronic
1172576818 20:36015673-36015695 TTGTTTCAGCTTTGACCATTGGG - Intronic
1175129031 20:56775419-56775441 ATGTTTCAGCACTAAGCACAGGG - Intergenic
1176714482 21:10338511-10338533 ATGTTTCAGCCATAAAGCTTTGG + Intergenic
1180485210 22:15788853-15788875 ATGTTTCAGCCAGAAACCTTTGG - Intergenic
1183412001 22:37660318-37660340 GTGTTTCAGCCCTCACAAGTAGG + Intronic
1184536745 22:45092742-45092764 ATGTTCAAGCCCTAACCCTCAGG + Intergenic
1184836312 22:47023979-47024001 TTGTTTCTGCTTTAACCATTTGG - Intronic
949472460 3:4410941-4410963 TTGTATAAGCCATAACCATTGGG + Exonic
949606355 3:5658522-5658544 ATGTTCAAGCCCTAATCTTTGGG - Intergenic
949906235 3:8861016-8861038 ATGTCTCAGCTCTCACCACTGGG - Intronic
950778598 3:15372051-15372073 ATGGTGAAGCCCTAACCATGTGG - Intergenic
956330973 3:68107897-68107919 ATGGTTCTGCCCTAGTCATTAGG + Intronic
961915818 3:130373665-130373687 ATGTTTCAGTCCAAATGATTAGG - Exonic
963760036 3:149278986-149279008 ATGGTTCAGCCCAAAGAATTTGG - Intergenic
964418391 3:156473991-156474013 ATGTTTCAGCCCTAACCATTTGG - Intronic
966021289 3:175214805-175214827 TAATTACAGCCCTAACCATTAGG + Intronic
969516494 4:7651101-7651123 ATGTTTCATCCCTAACTCCTAGG - Intronic
971319138 4:25591268-25591290 GTGTTCCAGCCCTAAAGATTTGG + Intergenic
971569203 4:28188365-28188387 ATATTTTAGTCCTAACCCTTAGG + Intergenic
973805103 4:54518165-54518187 ATGTTGAAGCCCTAACCCTCAGG + Intergenic
974670258 4:65021290-65021312 ATGTTTCAGGCCTTACCCCTAGG - Intergenic
974964112 4:68738733-68738755 ATGATTCAGCACTATCCCTTTGG - Intergenic
976522063 4:86039808-86039830 AGGTTTCAGGCCTATCCATGGGG + Intronic
978935507 4:114370030-114370052 ATCTTTCATCCCTAACCTTGAGG + Intergenic
981282993 4:142982349-142982371 ATGTTTTTCCCCTCACCATTTGG - Intergenic
984095312 4:175426989-175427011 ATATTACAGCCCTAGCAATTAGG + Intergenic
988385216 5:30554140-30554162 ATGTTGCAGCCCTAGCTATTGGG + Intergenic
989467527 5:41774568-41774590 TTGTTCCAGCCATAGCCATTGGG - Intronic
991644250 5:68785740-68785762 ATGCTGAAGCCCTAAACATTAGG + Intergenic
995566557 5:113436990-113437012 AAGTTGCAGCCCTATCCCTTTGG + Intronic
995626292 5:114080184-114080206 ATGTCTCATCCACAACCATTCGG - Intergenic
996218780 5:120902785-120902807 ATGTTTAAGAACTAAACATTGGG - Intergenic
998590719 5:143475137-143475159 TTGTGTCAGCCTTGACCATTGGG + Intergenic
998928128 5:147149851-147149873 ATGTTTTAGCTCTACCTATTAGG + Intergenic
1001471526 5:172016775-172016797 ATGGTTTAGCACTAACCCTTCGG + Intergenic
1002860418 6:1074893-1074915 ATGTCACAGCCCAAACAATTTGG - Intergenic
1002894069 6:1364893-1364915 ATGTTGAAGCCCTAACCTTCAGG - Intergenic
1004660857 6:17707905-17707927 ATTTTTCCTCCCTAATCATTTGG - Intergenic
1008055399 6:46940501-46940523 ATATTTCAGCCTTAGCCAGTTGG + Intronic
1008172341 6:48223792-48223814 ATGTATCATCACTAATCATTAGG - Intergenic
1008233632 6:49016238-49016260 ATGTTGAAGCCCTAACCACCCGG + Intergenic
1011156072 6:84334360-84334382 TTGCTTCAGCTTTAACCATTGGG - Intergenic
1012698225 6:102417387-102417409 GTGTTTCAGGCCTAAGCAATAGG - Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1019679867 7:2341093-2341115 CTGTTGCAGCCCCAACCACTTGG - Intronic
1019843501 7:3473934-3473956 GTCTTTCAGCCCAAACTATTTGG - Intronic
1022166150 7:27764850-27764872 TTGTTTCAGCTTTAGCCATTTGG + Intronic
1024840541 7:53581552-53581574 ATGTTTTATCTCTATCCATTAGG - Intergenic
1027434984 7:78155230-78155252 TTGTTTCAGACCTTAACATTGGG - Intronic
1027537003 7:79415763-79415785 TTGTTTCCTCCCTCACCATTGGG + Intronic
1029889023 7:103906737-103906759 ATGTTTTTACCCTAACCTTTTGG - Intronic
1032397169 7:131598927-131598949 ATGTTCAAGCCCTAACCCCTGGG - Intergenic
1033355179 7:140593642-140593664 AGGTTTCAGACCTAAACCTTTGG - Intronic
1040783875 8:51142301-51142323 ATGTTGAAACCCTAACCAATAGG + Intergenic
1041572597 8:59354023-59354045 ATGTTGCAGCCCCAACCTGTTGG + Intergenic
1043362607 8:79492830-79492852 TTTTTTTAGCCCAAACCATTAGG - Intergenic
1044086165 8:87944493-87944515 ATCTCTCAGCCCTGACCATTTGG + Intergenic
1044186468 8:89258125-89258147 ATGTTTGAGTTTTAACCATTTGG - Intergenic
1046066530 8:109203522-109203544 CTGTTTCAGCCTTGGCCATTGGG + Intergenic
1048276840 8:133072525-133072547 ATATTTCAGACCAAACCATTTGG - Intronic
1049027728 8:140007494-140007516 ATGTTTCATGCATCACCATTTGG + Intronic
1049112040 8:140652498-140652520 ATGTTACAGTCCTAAACATGAGG + Intergenic
1052405669 9:28057209-28057231 ATATTTCAGCCCAAATCAGTTGG - Intronic
1056638014 9:88347450-88347472 ATGTTCCCGCCAGAACCATTGGG - Intergenic
1059324085 9:113493008-113493030 AAGTTTCAGCCCTACCCAGTAGG + Intronic
1203682258 Un_KI270756v1:74493-74515 TTGTTCCAGTCCTATCCATTCGG + Intergenic
1186895685 X:14002447-14002469 ATGTTTCAGCCCTCGGCCTTAGG - Intergenic
1187768167 X:22666345-22666367 ATGTTTCATTTCTAACCATAAGG - Intergenic
1188489043 X:30717268-30717290 AAGTATCAGCACGAACCATTAGG - Intronic
1190722022 X:53156659-53156681 ATCTTTCAGCCTTCACCATAGGG - Intergenic
1191863892 X:65688612-65688634 AAGTTTCAGCTTTAAACATTTGG + Intronic
1193759378 X:85444868-85444890 AAGTGTCAGCCCTGACCATTTGG - Intergenic