ID: 964423891

View in Genome Browser
Species Human (GRCh38)
Location 3:156532259-156532281
Sequence GTGGGTTGAAAGGATGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964423882_964423891 15 Left 964423882 3:156532221-156532243 CCTGCAGCCATATTCTGGGGAGC 0: 1
1: 0
2: 2
3: 13
4: 126
Right 964423891 3:156532259-156532281 GTGGGTTGAAAGGATGTTCCTGG 0: 1
1: 0
2: 2
3: 11
4: 151
964423889_964423891 -7 Left 964423889 3:156532243-156532265 CCTGTAGTGGCAGTGGGTGGGTT 0: 1
1: 0
2: 0
3: 13
4: 158
Right 964423891 3:156532259-156532281 GTGGGTTGAAAGGATGTTCCTGG 0: 1
1: 0
2: 2
3: 11
4: 151
964423883_964423891 8 Left 964423883 3:156532228-156532250 CCATATTCTGGGGAGCCTGTAGT 0: 1
1: 0
2: 0
3: 4
4: 149
Right 964423891 3:156532259-156532281 GTGGGTTGAAAGGATGTTCCTGG 0: 1
1: 0
2: 2
3: 11
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964423891 Original CRISPR GTGGGTTGAAAGGATGTTCC TGG Intronic
901069383 1:6509616-6509638 GAGGGGAGAAAGGATGTTCAGGG - Intronic
905771305 1:40639716-40639738 CTGGGGAGAAAGCATGTTCCTGG - Intronic
907759291 1:57342188-57342210 AAGGGTTGGAAGGAAGTTCCAGG - Intronic
911971066 1:104438780-104438802 GTGAGCTGAAAGGATGTGCGAGG + Intergenic
917845336 1:179015528-179015550 GTGGAATGAATGAATGTTCCTGG - Intergenic
918535167 1:185565857-185565879 GTGAGTTAAACGGAGGTTCCAGG - Intergenic
920229666 1:204461954-204461976 GGGGGTGGAAAGGACGCTCCGGG - Intronic
1068559049 10:58492140-58492162 CTGGGTTGAAAGGACATTGCTGG + Intergenic
1069793858 10:71040184-71040206 GTGGGTAGGACGGATGTCCCAGG + Intergenic
1074219141 10:111419142-111419164 CTGGGTTGACAAGATGTTTCAGG + Intergenic
1074699366 10:116079741-116079763 GTGAGTTGAATGGTTCTTCCAGG - Intronic
1076583651 10:131531509-131531531 GTGGGTTTAGGGGGTGTTCCAGG + Intergenic
1077519588 11:3024358-3024380 GGGGGTTGAAATCATGCTCCTGG - Intronic
1079245018 11:18745510-18745532 GAGTGTTGGAGGGATGTTCCAGG - Intronic
1079365511 11:19805785-19805807 CTGGTTTGGAAGGATGTTGCGGG - Intronic
1079928557 11:26527721-26527743 GCAGGTTGAAAGGATGTTGTTGG + Intronic
1080578502 11:33622315-33622337 GCGGGTTGAAGGAATGTTCCTGG + Intronic
1080807493 11:35667639-35667661 GTGGGATTACAGGCTGTTCCTGG + Intronic
1083387450 11:62322055-62322077 GTGGCTGGAAAGGCTGCTCCAGG + Intergenic
1089403791 11:118180950-118180972 GTGGGTTGTGGGGAAGTTCCGGG - Intergenic
1089460159 11:118648340-118648362 GTGGGTTGTAAGGATGTGGCAGG + Intronic
1089600445 11:119611220-119611242 GTGGGCTAAAAGGATGGTGCAGG + Intergenic
1090914337 11:131149829-131149851 AAGGGTTGAAAGGATGTTAACGG + Intergenic
1092372824 12:7931388-7931410 GTCGGTTGAAATGCTGATCCTGG - Exonic
1096194438 12:49640824-49640846 CATGGTGGAAAGGATGTTCCAGG + Exonic
1098574753 12:72028512-72028534 ATGGGCTGCATGGATGTTCCTGG + Intronic
1099234173 12:80062521-80062543 GCAGGTAGAAAGGATGTTGCAGG - Intergenic
1102162581 12:110781696-110781718 GTGGGTGGCAAGGATGGCCCAGG - Intergenic
1103256200 12:119543546-119543568 GAGGGAAGAAAGAATGTTCCAGG + Intergenic
1104271671 12:127287900-127287922 CTGGATTAAAAGGATTTTCCTGG + Intergenic
1104630192 12:130394061-130394083 GTGGGTGGAAAGCCTGTACCTGG + Intergenic
1105255801 13:18743480-18743502 GAGGGTGGAAAGGGTGTACCTGG + Intergenic
1107470871 13:40689890-40689912 GTGGCCTGAAAGGATGGTTCTGG + Intergenic
1107885191 13:44869202-44869224 CTGGGTTGATAAGATGTGCCTGG + Intergenic
1110405458 13:75145338-75145360 TTGTGTTGAAAGTATTTTCCTGG + Intergenic
1111388823 13:87564496-87564518 GGTGGAGGAAAGGATGTTCCAGG - Intergenic
1113312922 13:109149745-109149767 GTGGGTAGAAAGGATTTTCCAGG - Intronic
1113435797 13:110290012-110290034 GTTGGCTGAAAGGATGCTGCCGG + Intronic
1113643021 13:111971797-111971819 GTGAGTGGCAGGGATGTTCCAGG + Intergenic
1117363558 14:55002362-55002384 CTGGGTTCAAGGGATCTTCCTGG + Intronic
1119737596 14:76993542-76993564 GTGGGTTCAAATGTTTTTCCTGG + Intergenic
1120940201 14:89940613-89940635 GAGGGTTAAAAGTAAGTTCCTGG + Intronic
1121505980 14:94477012-94477034 GAGAGTTGGAAGGATATTCCAGG - Intronic
1122407356 14:101508475-101508497 GTTGGATGAAAGGGTGTCCCGGG + Intergenic
1126694511 15:51314642-51314664 GTGGGTAGAGAGGACATTCCAGG - Intronic
1126773618 15:52081037-52081059 CTGGTATGACAGGATGTTCCAGG - Intergenic
1129898871 15:79130238-79130260 GTGAGTTGAATGCAGGTTCCTGG - Intergenic
1129899105 15:79131883-79131905 GTGAGTTGCAAGCAGGTTCCTGG - Intergenic
1130727708 15:86457724-86457746 GTTGGTTGAAAGGATGTCAAGGG + Intronic
1132083201 15:98884879-98884901 CTGGATTAAAAGGCTGTTCCAGG + Intronic
1133435123 16:5772611-5772633 GTGAGTTGAAAGGATGGTGGCGG + Intergenic
1133897443 16:9943072-9943094 GGGAGTGGAAAGGATGTTCAGGG - Intronic
1139116849 16:63964540-63964562 GTGGGTAGAACTGATGTTCTAGG - Intergenic
1140017367 16:71200456-71200478 GTGGCATGAATGGATGATCCAGG - Intronic
1143104103 17:4519869-4519891 GGGGGCTGAGAGAATGTTCCTGG - Intronic
1144969033 17:19095565-19095587 GGGAGTGGAGAGGATGTTCCAGG + Intronic
1144978883 17:19156501-19156523 GGGAGTGGAGAGGATGTTCCAGG - Intronic
1144989339 17:19221731-19221753 GGGAGTGGAGAGGATGTTCCAGG + Intronic
1146884681 17:36463309-36463331 GGGTTTTGAGAGGATGTTCCAGG - Intergenic
1148015974 17:44523040-44523062 GTGGATTGAAAGGATTTCCCTGG + Intergenic
1150262710 17:63808690-63808712 GTGGTTTTAAAGTATGTTCTAGG + Intronic
1152069004 17:78125988-78126010 CTTTGTTGAAAGGATTTTCCTGG - Intronic
1157422056 18:47555704-47555726 CTGGCTTGAAGGGATGTTCGTGG - Intergenic
1159965179 18:74588016-74588038 GGGGGTTGTAAGGGTGTTGCTGG - Intergenic
1160270921 18:77382796-77382818 GTGGGGTGATAGGATGACCCTGG + Intergenic
1161699827 19:5788456-5788478 GTGGGTAGAAGGGAGGCTCCAGG - Intronic
1165471471 19:36007030-36007052 ATGGGTTGAGTGCATGTTCCAGG - Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167156752 19:47743349-47743371 GTGGGAGGAAGGGATGTCCCGGG - Intergenic
1167716596 19:51146236-51146258 CTGGGTTGCAGGGAAGTTCCAGG - Intronic
1167768163 19:51497930-51497952 GTGGGTTGCAGGGAAATTCCAGG + Intronic
925771327 2:7285449-7285471 CTGGGTAGAAAGGATGTTGATGG + Intergenic
926466678 2:13198811-13198833 ATGGGTTGACAGGAAGTTCCGGG + Intergenic
929076032 2:38079566-38079588 GTTGATTGAAAGGAGATTCCTGG - Intronic
929831824 2:45353244-45353266 GTGGTTTGAAAAGATGTTTATGG - Intergenic
933085809 2:78053036-78053058 GTGGTTGGAAAGGATGTGGCTGG + Intergenic
934490798 2:94761039-94761061 GAGGGTGGAAAGGCTGTACCTGG + Intergenic
936935955 2:117838364-117838386 GAGGGCTGGAAGGATATTCCAGG + Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938541821 2:132289293-132289315 GTGTGTTGCAAGGATGCTGCTGG - Intergenic
940987596 2:160063820-160063842 GTGGGTTGAGAGGATGTGAGAGG + Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941869427 2:170368128-170368150 GTGTTTTGAAAAGATGTTCAAGG + Intronic
945396135 2:209321246-209321268 GTGGGTTAAAAGGAAGTCTCAGG + Intergenic
946232773 2:218302833-218302855 GTGTGTTGAAGGGAGCTTCCAGG + Intronic
947521589 2:230849996-230850018 GGTGCTGGAAAGGATGTTCCGGG + Intergenic
1171870694 20:30522174-30522196 GTGGGTTGCAAGGATGCTGCTGG - Intergenic
1176841813 21:13848507-13848529 GAGGGTGGAAAGGCTGTACCTGG + Intergenic
1179649284 21:42796355-42796377 GTGCGTTGCAAGGATGTAACAGG + Intergenic
1180047057 21:45311826-45311848 GTGTGTGGGGAGGATGTTCCGGG + Intergenic
1180597870 22:16990754-16990776 CTGCTTTGAAAGGATGTTTCTGG - Intronic
1180896357 22:19336507-19336529 CTGGTTAGAAAGGATGTTGCAGG - Intronic
1182496310 22:30710561-30710583 CTGGCTTGAAAACATGTTCCAGG + Intronic
1182512289 22:30827979-30828001 GTTGGTTGAATGGATGGTCAAGG + Intronic
1184957441 22:47900193-47900215 GTGGGCAGAAATGATGCTCCTGG - Intergenic
955478836 3:59368453-59368475 GTGGCTCGAAAAGATCTTCCAGG + Intergenic
957333677 3:78799072-78799094 GTGGGTTCCAATGATGGTCCTGG + Intronic
958914722 3:100036327-100036349 GTGGCATGAAAAGATGTTCCAGG - Intronic
959297906 3:104560798-104560820 GTGTTTTGAAAGGATTTTTCTGG + Intergenic
959829772 3:110846876-110846898 GTTGGTTGAAAAGATGTTCATGG - Intergenic
959966214 3:112358296-112358318 GTGGAATGAAAGGATGTTGTTGG + Intronic
960283649 3:115802992-115803014 GTGGGTTCAAAAGAGGCTCCTGG + Exonic
961441675 3:126957280-126957302 GAGGGTTAAAAGGATGCTGCTGG + Intronic
963968500 3:151401817-151401839 TTGGGTAGAAAGCATGTTCAGGG + Intronic
964423891 3:156532259-156532281 GTGGGTTGAAAGGATGTTCCTGG + Intronic
964728447 3:159839684-159839706 GTGGGTAGGAAGGATGATGCCGG + Intronic
965679404 3:171234908-171234930 TTGGGTTGAGAGGAGGTTACTGG - Intronic
966531312 3:180984205-180984227 TTCGGTGGAAAGGCTGTTCCAGG - Exonic
966799995 3:183754317-183754339 ATGGGCTGGAAGGATTTTCCAGG - Exonic
966843070 3:184105321-184105343 ATGGGTCTGAAGGATGTTCCGGG - Exonic
970474624 4:16409770-16409792 ATGGGTTGAATGGATGTTCATGG + Intergenic
971360261 4:25931889-25931911 GTGGGTTCAAAGTATAGTCCAGG - Intergenic
993940534 5:94052590-94052612 GTAGATTGCAAGGATGTTTCTGG - Intronic
994592708 5:101791953-101791975 GTGGTTTGAAAGGATGGTCCTGG - Intergenic
994851220 5:105057305-105057327 GTGGGAGGCAAGGATGTTCCTGG + Intergenic
996529653 5:124514753-124514775 GTGGGTTGAGAGCACATTCCAGG - Intergenic
998409549 5:141899131-141899153 GCAGGTTGAAAGGATGAGCCAGG + Intergenic
999591249 5:153148936-153148958 GTGGATTGAAAGGAAGCTCAAGG + Intergenic
1001067846 5:168553352-168553374 GTTGGTTGAAATGCTGATCCTGG - Exonic
1001908311 5:175492204-175492226 GTTGGTTAACAGAATGTTCCTGG - Exonic
1002654694 5:180736126-180736148 GTGGATTGAAAAAATATTCCTGG - Intergenic
1002835478 6:861647-861669 GGGGGTTGAGAGGCTGGTCCAGG - Intergenic
1002946597 6:1767177-1767199 GTGGGTGGAAAATATGTTTCCGG - Intronic
1006521357 6:34572982-34573004 GAGGGTTGAAAGGATGCTTTGGG - Intergenic
1007769339 6:44180521-44180543 GGGGGTTGGAAGGAAGCTCCTGG + Intronic
1007979331 6:46134440-46134462 TTGAGTTAAAAGGATGCTCCAGG - Intronic
1009902272 6:69821800-69821822 CTGTGAAGAAAGGATGTTCCAGG - Intergenic
1009963856 6:70556965-70556987 GTGGGTGGAAAGGAAGTAACAGG - Intronic
1010067629 6:71703549-71703571 CTAGGCTGAAAAGATGTTCCAGG + Intergenic
1010330282 6:74615630-74615652 GTGAGTAGGAAGGATGTTCCAGG - Intergenic
1011398714 6:86937364-86937386 GTGGGATGAAAAGATGAGCCCGG - Exonic
1014900460 6:126957553-126957575 GGTGGTTGCAAGTATGTTCCTGG - Intergenic
1016783862 6:147989039-147989061 GTGGGTTGTGATGATGTTTCCGG - Intergenic
1017046890 6:150355501-150355523 GTGGGTTGAAACACTGTTCTGGG + Intergenic
1020839362 7:13195651-13195673 GGGGCTTGGAGGGATGTTCCAGG + Intergenic
1022783364 7:33609801-33609823 GTGGGTGGTAATGATATTCCTGG + Intergenic
1023348585 7:39296631-39296653 GTGGGGAGGAAGGAGGTTCCAGG - Intronic
1023363051 7:39435161-39435183 GCGGGGTCAAATGATGTTCCAGG + Intronic
1027820272 7:83033502-83033524 GTGGGATGGAAGGATATTCTAGG - Intronic
1028876031 7:95824333-95824355 GAGGGTTGAAAAAATGTTCAAGG - Intronic
1031842229 7:126757813-126757835 GTTGGTTGAAAAGGTGTTCAGGG - Intronic
1032223866 7:130014752-130014774 TGGGGTTAAAAGGATGTCCCAGG + Intergenic
1033315410 7:140292862-140292884 GTGGGATGAAATGAACTTCCTGG + Intergenic
1035677067 8:1463450-1463472 GTGGGTTCGAAGGGAGTTCCTGG - Intergenic
1037595960 8:20354292-20354314 GTGGGTTGGAGCGATGTTCATGG + Intergenic
1038747484 8:30267238-30267260 GTGGTCTGTAAAGATGTTCCCGG - Intergenic
1038758138 8:30361005-30361027 GTGGGCTGAAGGGATCTTCATGG - Intergenic
1039065271 8:33602127-33602149 GTAGGTTGAGAGGATGTTGTAGG + Intergenic
1043536385 8:81209588-81209610 GTGGGATGAAAGAATATTCCAGG - Intergenic
1045500546 8:102741160-102741182 AAGGGATGAAAGGATGTTTCTGG - Intergenic
1052954954 9:34246679-34246701 GTGGGTTAAAAGGAGGTTTATGG + Intronic
1058415095 9:104779081-104779103 GTGGGTGCGAAGGATATTCCCGG - Intergenic
1061278849 9:129585575-129585597 GTGGGAAGAAAGGATATTCTAGG + Intergenic
1061493743 9:130960154-130960176 GTGAGCTGAAAGAAAGTTCCAGG - Intergenic
1061789647 9:133052301-133052323 GTGGGTAGGAAGGATGGGCCAGG - Intronic
1187474699 X:19600694-19600716 CTGAGTTGAAAGGATGTTTTTGG - Intronic
1188505166 X:30874610-30874632 GTGAGTAGCAAGGATGTTGCTGG + Intronic
1189120728 X:38391731-38391753 GTGGTGTGACAAGATGTTCCAGG + Intronic
1192639296 X:72847252-72847274 GTGGGTTGCAAGGCTGGTGCAGG - Exonic
1192642415 X:72873553-72873575 GTGGGTTGCAAGGCTGGTGCAGG + Exonic
1197795867 X:130297999-130298021 CTGGTATGACAGGATGTTCCAGG - Intergenic
1198367994 X:135962226-135962248 GTGGCTTGACAGCATCTTCCTGG - Exonic