ID: 964424370

View in Genome Browser
Species Human (GRCh38)
Location 3:156535670-156535692
Sequence CTGAGTAACTAGAAGTATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964424370_964424373 15 Left 964424370 3:156535670-156535692 CCAATATACTTCTAGTTACTCAG 0: 1
1: 0
2: 4
3: 20
4: 197
Right 964424373 3:156535708-156535730 CTTCCCCCAAAATGTCTCTCAGG 0: 1
1: 0
2: 3
3: 10
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964424370 Original CRISPR CTGAGTAACTAGAAGTATAT TGG (reversed) Intronic
901220808 1:7582838-7582860 CTGAGGAACCAGAAGGAAATGGG + Intronic
903422536 1:23228484-23228506 CTGAGTAGTTAAAACTATATAGG - Intergenic
904705992 1:32391266-32391288 CTGAGTAAAGATAAGTTTATAGG + Intronic
904778975 1:32930529-32930551 CTGAGTAGCTGGAACTATACAGG + Intergenic
904964727 1:34362688-34362710 CTGAGTATCTCGAATTTTATTGG - Intergenic
906139047 1:43522551-43522573 ATGTGTAACAAGAAGTATAAAGG + Intergenic
906554552 1:46698183-46698205 CTGAGTAAGTAGTAGTAGCTTGG + Intronic
907684224 1:56594303-56594325 CTGAATAACTAGAAGGATGGAGG + Intronic
907690716 1:56662717-56662739 ATGAGTAACTAAAAGAAAATAGG + Intronic
908422699 1:63974761-63974783 CTGAGTAGCTAGAACTATATAGG + Intronic
909878734 1:80845920-80845942 CTGAGTTATTAGAAGCATAATGG - Intergenic
910572603 1:88722655-88722677 CTGAGTAACTGGAACTATATAGG - Intronic
913707957 1:121446939-121446961 CAGAGTAAGTATAAGTATATTGG + Intergenic
914915934 1:151819221-151819243 CTAAGTGACTAGAAGTATGGGGG - Intronic
915355346 1:155252321-155252343 CTGAGTAGCTGGAATTATAAGGG + Intronic
915378012 1:155415039-155415061 CTGTGTAACTAAAATGATATTGG - Intronic
916251139 1:162739430-162739452 CTGAGTAACTGGGATTACATGGG + Intronic
917588254 1:176450662-176450684 CTGAGTCACTAGAAGCACACAGG - Intergenic
917983460 1:180290313-180290335 CTGAGTAGTTATAACTATATAGG + Intronic
918763291 1:188444006-188444028 CTGAGTAACTCGATGTATGGTGG + Intergenic
919527995 1:198678955-198678977 GTGAGTGACTAGAATTATAAAGG + Intronic
922313352 1:224417578-224417600 CTGAGTAGCTAGGACTATATAGG - Intronic
922360885 1:224820217-224820239 CCAAGTAAATAGAATTATATTGG - Intergenic
922595814 1:226812035-226812057 CTGGGTGACTTAAAGTATATGGG + Intergenic
923344486 1:233037648-233037670 CTGGGAACCTAGAAGTGTATTGG + Intronic
1063014952 10:2066705-2066727 CTGAGTAGCTGGGACTATATAGG - Intergenic
1063063283 10:2580387-2580409 TTGGGTAACTAAAAGAATATTGG - Intergenic
1066137318 10:32462297-32462319 CTGAGTAGCTAGGACTACATGGG - Intronic
1068376159 10:56183977-56183999 GTGAATAAGTAGAATTATATAGG + Intergenic
1069440944 10:68427521-68427543 CTGAGTAACTAGAACTATACAGG - Intronic
1069854222 10:71430692-71430714 CTGAGTAGCTGGGAGTACATGGG - Intronic
1070581181 10:77720795-77720817 CTGAGTAGCTGGAATTATAGGGG - Intergenic
1071040361 10:81301395-81301417 CTTACTATCTAGTAGTATATTGG - Intergenic
1072894327 10:99353245-99353267 CTGAGGAAACAGAAGTAAATAGG + Intronic
1073089500 10:100922725-100922747 CTGAGTAGCTGGGACTATATAGG + Intronic
1073213337 10:101822214-101822236 CTGAGCAACTAGATGGATGTTGG + Intergenic
1074203706 10:111261935-111261957 CTAAGTGACAAGAAGTACATTGG + Intergenic
1078827992 11:14950231-14950253 CTGAGAAACTAGAAGGACAAAGG - Intronic
1079177030 11:18151846-18151868 CTGAGCACCTAGAAGCATTTTGG - Intronic
1079461209 11:20679775-20679797 CTGAGGATCTAGGAGTATCTAGG - Intronic
1080337660 11:31216705-31216727 CTGAGTAACTAGTACTGTCTGGG - Intronic
1083075923 11:60037637-60037659 CTGGCTAACTAGAAGAAAATTGG + Intergenic
1085942020 11:81216014-81216036 CTGAGTAATTAAAAGTGTAGTGG - Intergenic
1088496691 11:110438549-110438571 CTGAGTAGCTGGAATTATAAAGG + Intronic
1090163701 11:124523250-124523272 CTGAGTAGCTGGGACTATATAGG - Intergenic
1092292933 12:7174786-7174808 CTCAGTAACTATAAGAATGTGGG - Intergenic
1092368150 12:7894260-7894282 CCGAGTAGCTAGGAGTATAGGGG - Intergenic
1093549490 12:20390553-20390575 CTGAGAAACTAGAAAGATAGTGG + Intronic
1096311939 12:50529164-50529186 CTGAGTAACTGGGACTATTTTGG - Intronic
1096800616 12:54108074-54108096 CTGGGTACCTAGAAGTCTCTAGG + Intergenic
1098125868 12:67292210-67292232 CTGAGTAACTAGGACTACAAGGG - Intronic
1098127007 12:67307557-67307579 CTTAGTAACTAGAAATATCGAGG + Intronic
1099260463 12:80374451-80374473 CTTAGTAATTAAAAATATATAGG - Intronic
1099282148 12:80664097-80664119 CTGTGTTACTAGAAGTGTATTGG + Intronic
1099308926 12:80993958-80993980 CTGAGTAGCTAGGACTATAGGGG + Intronic
1104335081 12:127886981-127887003 CTGAGCAAATACAAGTTTATGGG - Intergenic
1104516146 12:129429069-129429091 GTGAGTAACTTGAAGGATTTTGG - Intronic
1104516150 12:129429127-129429149 GTGAGTAACTTGAAGGATTTTGG - Intronic
1105469277 13:20677577-20677599 CAGAGCACCTAGAAGTAAATTGG + Intronic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106385890 13:29285566-29285588 CTGATTTACTAGAAGTACAAAGG + Intronic
1106646782 13:31643556-31643578 CAGAGAAAACAGAAGTATATAGG + Intergenic
1110297365 13:73884233-73884255 CTGAGAAAAGAGAAGAATATAGG - Intronic
1110667085 13:78129630-78129652 CTGAGTAACTAGACTAATCTAGG + Intergenic
1112403703 13:99099164-99099186 CTGAGTAACTTGAAATCTCTTGG + Intergenic
1117714745 14:58569118-58569140 TTGAGTAACTAGGTTTATATAGG + Intergenic
1118107686 14:62678751-62678773 CTGTGTAACTACAAGTATTTTGG - Intergenic
1121769718 14:96522534-96522556 CTGAGTAGCTGGGACTATATAGG + Intronic
1123167486 14:106340046-106340068 CTGAGTATCTAGAATTAGAGGGG - Intergenic
1123199402 14:106647916-106647938 CTGAGTATCTACAACTAGATGGG - Intergenic
1123221392 14:106860059-106860081 CTGAGTATCTAGAAGTAGAGGGG - Intergenic
1123960575 15:25395413-25395435 CAGAGTAAACAGAAGTATAATGG + Intronic
1124996900 15:34732308-34732330 CTGACTAATTAGAAGTAGACAGG + Intergenic
1125188494 15:36961485-36961507 CTGAGTAAATACAAATAAATTGG + Intronic
1127106099 15:55617888-55617910 GTTGGTAAGTAGAAGTATATAGG - Exonic
1127548404 15:60012093-60012115 CTGAGTAAATAAAAATATACAGG - Intronic
1128190262 15:65686813-65686835 CTGAGTAGCTAGGACTACATAGG + Intronic
1128763188 15:70233209-70233231 CTTAGAAATTAAAAGTATATTGG - Intergenic
1131617579 15:94032830-94032852 CTGAGTAGCTAGGAATATAGGGG + Intergenic
1131677011 15:94680880-94680902 CTGAGAGACTGGAAGGATATAGG - Intergenic
1133243407 16:4430046-4430068 CTGAGTAGCTAGGACTATAGAGG - Intronic
1133333799 16:4993166-4993188 CTGAGTAGCTGGGACTATATAGG + Intronic
1133439898 16:5812290-5812312 TTGAGTAGCTAGAAGTAGAAAGG + Intergenic
1134593112 16:15473414-15473436 CTGAGTAGCTGGGATTATATAGG + Intronic
1135294528 16:21267745-21267767 GGGAGTAACAAGAAGGATATTGG + Intronic
1135384449 16:22024488-22024510 CTGAGTAGCTGGGACTATATAGG + Intronic
1135433095 16:22403813-22403835 CTGAGTAGCTAGGACTATATAGG + Intronic
1136548518 16:30968980-30969002 CTGAGTAACTGGGACTATACAGG - Intronic
1138336143 16:56254192-56254214 TTGAATTACTAGAAATATATAGG - Intronic
1139389795 16:66600266-66600288 CTGAGTAGCTAGAACTACAGGGG + Intergenic
1139507907 16:67408610-67408632 CTGAGTAGCTAGAAATACAGCGG + Intronic
1139571939 16:67818389-67818411 CTGAGTAGCTAGGACTACATGGG - Intronic
1141259249 16:82436891-82436913 CTGAGTAGCTGGGATTATATGGG + Intergenic
1143073393 17:4317391-4317413 CCGAGTAACTGGGACTATATAGG - Intronic
1143407119 17:6685036-6685058 CCGAGTAACTTCAAGTAGATTGG + Exonic
1143860136 17:9884097-9884119 ATGAGTAAATAGAGATATATAGG + Intronic
1144200301 17:12935043-12935065 CTGAGTCACTAAATTTATATCGG + Intronic
1146440115 17:32886662-32886684 CTGAGTAGCTAGGACTATATAGG + Intergenic
1146764920 17:35511615-35511637 CTGAGTAGCTAGGACTATAGGGG - Intronic
1148464049 17:47854006-47854028 TTGAGTAGCAATAAGTATATGGG - Intronic
1149052230 17:52319375-52319397 CTGAGTATCTACTAGAATATAGG + Intergenic
1149889233 17:60371441-60371463 CTGAGTAGCTGGGATTATATAGG - Intronic
1153143809 18:2005598-2005620 CAGAATAACTAGAATTATAAAGG + Intergenic
1153735700 18:8064826-8064848 CTGAGTAACTAATATTATAGTGG - Intronic
1155534083 18:26797368-26797390 CTGAGTAGCTGGAACTATAAGGG - Intergenic
1155679176 18:28468524-28468546 ATGTGTAATTAGAAGTTTATTGG + Intergenic
1156249088 18:35333743-35333765 ATGAATAACTAGAAATTTATTGG - Exonic
1158481633 18:57826546-57826568 CTGAGGATCTAGAAGTATAATGG + Intergenic
1158494724 18:57944238-57944260 CTGAGTAGCTGGAACTTTATAGG + Intergenic
1160902868 19:1437670-1437692 AGGAGTAACTAGAACTATGTAGG - Intergenic
1161909244 19:7180402-7180424 CTGAGTAGCTGGGACTATATAGG - Intronic
1168544436 19:57239108-57239130 CTGAGTAACTGGAATTACAGGGG + Intergenic
926665221 2:15514350-15514372 CTGAATAAATAGAAATATAAGGG + Intronic
926931169 2:18042605-18042627 CTGAGGAATTAGAAGCATAGGGG - Intronic
930165934 2:48203964-48203986 CTGAGTAGCTAGGACTATAGGGG - Intergenic
943967670 2:194358097-194358119 TTAAATAACTAAAAGTATATTGG + Intergenic
944075935 2:195730843-195730865 TTGAGCAACTAGAAGAATAGAGG - Intronic
944619879 2:201503518-201503540 CTGAGTAGCTGGAACTATAGGGG + Intronic
1171852395 20:30317875-30317897 CTGGGTACCTAGAAGTCTCTAGG + Intergenic
1172082552 20:32353741-32353763 CTGAGTAGCTAGGAGTAGGTAGG - Intergenic
1180223905 21:46377720-46377742 CTGAGTAGCTGGAACTATATGGG - Intronic
1181843995 22:25691370-25691392 TTGTGTAACTAGAAGTAAAGTGG + Intronic
1182472816 22:30559030-30559052 CTGAGTAACTGGGACTATAGGGG - Intronic
1182650045 22:31844275-31844297 CTGAGTAGCTAGGACTATAGGGG - Intronic
1183375300 22:37461175-37461197 CTGAGTAGCTGGAACTATAGGGG - Intergenic
949929820 3:9069819-9069841 CTGAGTAGCTAGGAGTACAGGGG - Intronic
954142219 3:48613973-48613995 CTGAGTAGCTGGAACTATATAGG + Intergenic
954897655 3:53990457-53990479 CTGTGGAACTGGAAGTAAATGGG + Intergenic
957150272 3:76477552-76477574 CAGAGAAACTAGAGGTATAATGG - Intronic
958193465 3:90212540-90212562 CTGAGTAACTGGAATTATAAGGG - Intergenic
958943829 3:100341915-100341937 CTGAGTAGCTGGGACTATATAGG - Intronic
959288835 3:104446986-104447008 CTAAGTAAATAGAAGTAAGTAGG + Intergenic
960519295 3:118636831-118636853 ATGAGTGACTAGAAGAATACAGG - Intergenic
961142389 3:124566377-124566399 CTGAGTAGCTGGGACTATATAGG - Intronic
962108057 3:132414274-132414296 CTGAGTAACTAGCACTACAGGGG + Intergenic
962573593 3:136735736-136735758 CTGAGTAGCTGGAATTATAGGGG + Intronic
962952552 3:140232735-140232757 CTGAGTAACTGGGTGGATATTGG - Intronic
963609254 3:147444288-147444310 CTGAGTAACTATTAATACATGGG - Intronic
963951495 3:151207181-151207203 CTGAGTAACTAGGACTACAGGGG + Intronic
964424370 3:156535670-156535692 CTGAGTAACTAGAAGTATATTGG - Intronic
964963488 3:162458476-162458498 CTAAGTAGCTAGAACTATAGGGG - Intergenic
965012406 3:163111420-163111442 CTGATAAACTGGAAGAATATTGG + Intergenic
965560797 3:170060643-170060665 CTGAGTAGCTAGGACTATAGAGG - Intronic
966394116 3:179484205-179484227 TTGAGAAACTAGACTTATATAGG + Intergenic
966709657 3:182957810-182957832 CCGAGTAGCTGGAACTATATAGG - Intronic
967438973 3:189484659-189484681 CTGAGTAGCTGGGACTATATAGG - Intergenic
967870781 3:194227213-194227235 CTGAGTAACTAGGTGGATGTTGG - Intergenic
972100021 4:35403824-35403846 CTGAGAACCTAGAAGCATAGAGG - Intergenic
974962941 4:68726093-68726115 CTAAATACCTAGAAGTAAATTGG + Intergenic
975634734 4:76436343-76436365 CTGATTATCTAGAAATATTTTGG + Intronic
976369961 4:84276371-84276393 GAGAGTAACTAGAAGTAGAAAGG - Intergenic
976501943 4:85801204-85801226 CTGAGTAAAAAGTAGGATATAGG - Intronic
976762469 4:88564978-88565000 CTGAATGACCAGAAGCATATTGG - Intronic
976833706 4:89346202-89346224 CTGAGTCACTAGCACTATAGTGG + Intergenic
977196028 4:94061178-94061200 CTGTGTATCCTGAAGTATATAGG - Intergenic
980439949 4:132829361-132829383 CTGAGCAACTGGAAGGATAAAGG - Intergenic
981642206 4:146957536-146957558 CGGACTAACTAGTAGTAAATCGG + Intergenic
986046380 5:4042189-4042211 CTGAGAATCTAGAAGTGTACAGG + Intergenic
989970134 5:50513753-50513775 CAGAGTAAGTATAAGTACATTGG - Intergenic
991095275 5:62733108-62733130 CTGAGTGACTAGAATCATCTAGG + Intergenic
992717662 5:79526904-79526926 CTGAGTAGCTAGAACTATATAGG - Intergenic
993507741 5:88732116-88732138 CTGAGCAAGTTGATGTATATTGG - Intronic
996616966 5:125453632-125453654 CTGAGTAATTCAATGTATATAGG - Intergenic
997019012 5:129974554-129974576 TTGAGGAACTATAAGTACATAGG - Intronic
997292764 5:132749128-132749150 CTGAGTAGCTAGGACTATAGGGG - Intronic
998357575 5:141553515-141553537 CTGAGTAGCTGGAATTACATAGG - Intronic
999012862 5:148061697-148061719 CTGAGTAAATATAAATCTATTGG + Intronic
1000186156 5:158860084-158860106 GTGCGGAACTAGAAGTTTATTGG - Intronic
1000653224 5:163843634-163843656 GTCAGTACCTACAAGTATATTGG + Intergenic
1001633385 5:173192960-173192982 CTGAGCTTCTAGAAGAATATGGG + Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003931582 6:10929015-10929037 CTGAGTAGCTAGGATTATAGGGG + Intronic
1004529095 6:16437005-16437027 CTGAGTAACTGGAAGGAGATGGG + Intronic
1004904804 6:20227578-20227600 CTGAGTAGCTAGAACTACAAAGG + Intergenic
1007052311 6:38844684-38844706 CTGAGCAACTAGATGTATCTGGG - Intronic
1007674647 6:43583040-43583062 TGGAGTCACTAGAAGTATGTGGG + Exonic
1008359735 6:50601426-50601448 CTTTGTATCTTGAAGTATATAGG - Intergenic
1008757660 6:54816753-54816775 CTGAGTGACTAGAAGAATAGTGG - Intergenic
1011646129 6:89459623-89459645 CTGAGTAGCTAGAACTATACAGG + Intronic
1012979102 6:105811348-105811370 CTGGGTCACTGGAGGTATATTGG - Intergenic
1016316231 6:142791021-142791043 CTCAGTTATTAGAAGTAGATAGG - Intronic
1016753271 6:147654877-147654899 CTGAGTCACTAGAAGCATCTGGG + Intronic
1016921355 6:149297648-149297670 CTGAGTAGCTAGGACTATAGGGG + Intronic
1017456384 6:154604896-154604918 CTGAGTAGCTAGAATTACAGGGG + Intergenic
1020646239 7:10817637-10817659 CTGAGCAACTAGAAGGCAATTGG + Intergenic
1024180424 7:46887690-46887712 CTGAGTAGCTAGGACCATATGGG - Intergenic
1031282530 7:119821786-119821808 CTGAGTAGCTAGAACTACAGGGG + Intergenic
1031687130 7:124744764-124744786 CTGAGTAACTAAAGGTAAATAGG - Intergenic
1032333626 7:131003933-131003955 CTAAGTAATTTGAAGTAGATAGG - Intergenic
1034675100 7:152887189-152887211 CCGAGTAGCTAGGATTATATAGG + Intergenic
1034716616 7:153248960-153248982 ATGAGTAACAAGATGGATATAGG + Intergenic
1036000065 8:4592510-4592532 CTGAGTAGCTAGAACTACAGGGG + Intronic
1037417324 8:18666174-18666196 CTGAGTAGCTGGAATTATAGGGG + Intronic
1038635267 8:29281569-29281591 GGAAGTAACTAGAAATATATGGG + Intergenic
1039538510 8:38341818-38341840 CCGAGTAGCTGGGAGTATATAGG - Intronic
1040545498 8:48395660-48395682 CTGAGTAGCTAGAACTACAGGGG - Intergenic
1040771742 8:50986371-50986393 CTGATTGACTATAAATATATGGG + Intergenic
1041170439 8:55136481-55136503 TTGAGTAAGTAGTAGTATGTGGG + Intronic
1041517791 8:58720623-58720645 CTAAGAAACTAGAAATATAAGGG + Intergenic
1045030671 8:98132506-98132528 CTCAGTAACTAGAACTAAAAGGG - Intronic
1045599587 8:103697600-103697622 CTGAGTAGCTAGGACTATAGGGG - Intronic
1053790180 9:41681153-41681175 CTGGGTACCTAGAAGTCTCTAGG + Intergenic
1054154958 9:61633604-61633626 CTGGGTAGCTAGAAGTCTCTAGG - Intergenic
1054178521 9:61892842-61892864 CTGGGTACCTAGAAGTCTCTAGG + Intergenic
1054474749 9:65564712-65564734 CTGGGTACCTAGAAGTCTCTAGG - Intergenic
1054659008 9:67687982-67688004 CTGGGTACCTAGAAGTCTCTAGG - Intergenic
1056434331 9:86560704-86560726 CTGAGTCACTAGAAGAATTTTGG + Intergenic
1056493069 9:87126870-87126892 ATGAGTAACTAACACTATATTGG - Intergenic
1056615548 9:88162397-88162419 CTGAGTAGCTGGAACTATAGGGG + Intergenic
1058513404 9:105744257-105744279 CTGAATAACTTGAAATTTATAGG + Intronic
1188694387 X:33172039-33172061 GTGAGTAACTAGAAATGCATGGG + Intronic
1190123821 X:47685913-47685935 CTGAGGTAATAGAAGTATCTTGG - Intergenic
1194369169 X:93049202-93049224 CTGAGTACCTTGAAGTCTATTGG - Intergenic
1194640272 X:96395615-96395637 CTGAGTAATTTGAAATTTATTGG + Intergenic
1194746272 X:97631824-97631846 CTGAGAAAGTATATGTATATCGG - Intergenic
1194978221 X:100413925-100413947 CTGAGTAGCTAGGATTATACAGG + Intergenic
1197284454 X:124579871-124579893 CTGAGTGACTAGAAAAATGTTGG + Intronic
1197557911 X:127978708-127978730 CTGAGTGACTAGAACAATAAGGG - Intergenic
1197656607 X:129123467-129123489 CTGATTATATAGAAGTAGATGGG + Intergenic
1200677375 Y:6165533-6165555 CTGAGTACCTTGAAGTCTATTGG - Intergenic
1201785624 Y:17774858-17774880 CTGAGTAGCTAAAATTATAGGGG - Intergenic
1201815929 Y:18131130-18131152 CTGAGTAGCTAAAATTATAGGGG + Intergenic