ID: 964425222

View in Genome Browser
Species Human (GRCh38)
Location 3:156545948-156545970
Sequence GTAAGCAACCTGACTTCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964425222_964425225 -10 Left 964425222 3:156545948-156545970 CCCAGTGAAGTCAGGTTGCTTAC 0: 1
1: 0
2: 0
3: 8
4: 129
Right 964425225 3:156545961-156545983 GGTTGCTTACGTAGGTTATTAGG 0: 1
1: 0
2: 0
3: 7
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964425222 Original CRISPR GTAAGCAACCTGACTTCACT GGG (reversed) Intronic
900744094 1:4349291-4349313 GTTTGTAACCTGTCTTCACTTGG - Intergenic
904317260 1:29673505-29673527 GTAAGATACTTGACTTCTCTGGG + Intergenic
907150395 1:52280738-52280760 ATCAGCAACATGACTTTACTTGG - Intronic
916084704 1:161259775-161259797 CTAACCAGACTGACTTCACTTGG - Intronic
918474603 1:184910255-184910277 GAAAGCAACTTGAGTTCATTTGG + Intronic
920089103 1:203439898-203439920 GTGACCAACCTGACTTCAGAAGG + Intergenic
921620712 1:217323479-217323501 GTAAGAAACCTGACTTGGCCAGG + Intergenic
923159165 1:231302467-231302489 TTTAACAACCTGACTGCACTCGG + Intergenic
924904389 1:248436010-248436032 GCCAGCAACCTGACTTATCTTGG + Intergenic
924923497 1:248656038-248656060 GCCAGCAACCTGACTTATCTTGG - Intergenic
1066589404 10:36977364-36977386 GTAAGCAACCTGACAATATTTGG + Intergenic
1067013476 10:42737075-42737097 GTAAGCACCCTGATTTCCTTAGG - Intergenic
1067522983 10:47022037-47022059 GTAAGAAACCTGGGTTCTCTTGG - Intergenic
1069124979 10:64619106-64619128 GTGAACAATCTGACTCCACTAGG - Intergenic
1070977977 10:80620558-80620580 GTAAGCAACCTGTCCTCCCCAGG - Intronic
1074277283 10:112015596-112015618 GAAAGCAACCTGAGTTAACTTGG - Intergenic
1075560269 10:123463073-123463095 GTAATCAAGCTGATTTCACTGGG + Intergenic
1075576650 10:123582614-123582636 GTAAGCCACTTGCCTTCTCTGGG + Intergenic
1078156371 11:8803461-8803483 GGAAGTAACTTGACTTCTCTAGG - Intronic
1082199730 11:49351284-49351306 GTAAGCAAAAGGAGTTCACTGGG + Intergenic
1086452972 11:86935187-86935209 TTAAGTCACCTGACTTCTCTAGG + Intronic
1086655934 11:89354939-89354961 GTAAGCAAAAGGAGTTCACTGGG - Intronic
1088347519 11:108844866-108844888 GCAAGCAACCTGACTTGTCAGGG - Intronic
1089642798 11:119858879-119858901 GTGAAAAATCTGACTTCACTTGG + Intergenic
1096436726 12:51597266-51597288 GTAGGCATCCTGTATTCACTGGG + Intronic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1103890231 12:124232773-124232795 GGCAGCAAGATGACTTCACTTGG + Intronic
1103984862 12:124760475-124760497 GTGAACGACCTGACTTCTCTGGG + Intergenic
1108323390 13:49307318-49307340 GTAGGTAACTTAACTTCACTTGG - Intergenic
1112391987 13:98993573-98993595 GAAAACAACATGTCTTCACTAGG + Intronic
1117708260 14:58496216-58496238 ATAGGCAACCTGACTTAAATTGG + Intronic
1129975700 15:79819620-79819642 CCAAGCTACCTGAATTCACTTGG + Intergenic
1130050365 15:80479167-80479189 ACAAGAAACCTGACTTCACTGGG + Intronic
1132072819 15:98794560-98794582 GTAAGCAAACTGTCTCCATTAGG + Intronic
1135783471 16:25326773-25326795 GTATGCAAGTTGACTTTACTGGG + Intergenic
1135942887 16:26838121-26838143 GTAAGGACCCTGCCTTTACTAGG + Intergenic
1138128068 16:54455088-54455110 GTAAACACCCTGGCTTCACGAGG - Intergenic
1148022963 17:44565782-44565804 GTCAGCAAACTGAGTTCCCTGGG + Intergenic
1151004325 17:70416293-70416315 TTAAGCAACTTAACTTCTCTAGG + Intergenic
1151919444 17:77142121-77142143 GTAAGCCATTTGACTTCCCTAGG - Intronic
1156422221 18:36967343-36967365 GTCAGCAACCTGAATGAACTTGG + Intronic
1157236562 18:45970142-45970164 ATAAGCAACCTGAGTTCCCAGGG + Intergenic
1157644681 18:49255731-49255753 GGAAACAATATGACTTCACTGGG + Intronic
1157769803 18:50335840-50335862 GTCAGCAACCTGACATTACTGGG + Intergenic
1159962031 18:74562894-74562916 GCAAGCAACTTGACCTCTCTGGG + Intronic
1161347875 19:3777163-3777185 GTGAGCAACCTGCCCTCTCTGGG + Intergenic
1162218614 19:9157373-9157395 TACAGCAACCTCACTTCACTGGG + Exonic
1168156638 19:54476967-54476989 GTAAGAATCCAGAGTTCACTGGG + Intergenic
926448839 2:12977363-12977385 GAAAGCAATATGACTTCTCTGGG + Intergenic
930206966 2:48597366-48597388 TTAACCCACCTAACTTCACTGGG - Exonic
930692850 2:54382028-54382050 GTGAGCTACCTAACTTCTCTGGG - Intronic
931146056 2:59519902-59519924 GGAAGCATCCTGAATTCATTAGG + Intergenic
936673306 2:114684558-114684580 GTAAGAAACTTGACTGCACTAGG + Intronic
937251841 2:120528822-120528844 GTAAGTCACCTAACTTCCCTGGG - Intergenic
939021391 2:136961972-136961994 ATTAGCAACCTTAATTCACTTGG - Intronic
940908101 2:159186691-159186713 GGAACCAGCCTGCCTTCACTAGG - Intronic
941334739 2:164228565-164228587 GCCAGCAACCTGAGTGCACTTGG + Intergenic
942312479 2:174668284-174668306 GCAAGCTACCTGACTTCTCCGGG + Intronic
944249594 2:197567816-197567838 GTAAGCAACAGAACTTAACTTGG - Intergenic
945442183 2:209893644-209893666 CTAAACAATCTGTCTTCACTGGG - Intronic
1168841013 20:910219-910241 ACAAGCAATCTTACTTCACTGGG + Intronic
1172657796 20:36547689-36547711 GTAAGAATGCTGACTTCACAGGG + Intronic
1173653829 20:44685209-44685231 GTAAGCAACTTCACCTCTCTGGG - Intergenic
1173759751 20:45549127-45549149 GTCAGCATCCTCACTTCTCTGGG - Intergenic
1182912431 22:33996302-33996324 GTTAGCATCCTAACTCCACTGGG - Intergenic
1183236740 22:36624421-36624443 GTGAGCAGCCTGACCTCTCTGGG - Intronic
950023558 3:9805889-9805911 GAAAGCAACCTCAGTTCACCAGG + Intronic
950070731 3:10150104-10150126 GAAAGTTAACTGACTTCACTAGG + Exonic
952097424 3:29970128-29970150 GTAGGAAACATGACTTCATTGGG + Intronic
958879037 3:99648628-99648650 CCAAGCAACTTGTCTTCACTTGG - Intronic
959750749 3:109831695-109831717 GTAAGCAACGTGACTCACCTCGG - Intergenic
959989364 3:112613747-112613769 GTGGGCAACCTGAGTTTACTGGG + Intronic
960385305 3:117015651-117015673 GTAACGAACCTGGCTTCGCTGGG + Intronic
964425222 3:156545948-156545970 GTAAGCAACCTGACTTCACTGGG - Intronic
964640928 3:158909869-158909891 GAAAGCAAAATAACTTCACTGGG - Intergenic
966195737 3:177312223-177312245 CAAAGCAACCAGAATTCACTAGG - Intergenic
966851276 3:184166567-184166589 ATACGCATCCTGCCTTCACTAGG + Intronic
969432166 4:7161723-7161745 GGCAGGAACCTGACTTCAATGGG - Intergenic
970003776 4:11390908-11390930 GTAAGCAACAGACCTTCACTTGG + Intergenic
971119135 4:23684610-23684632 GTTAGCAAGCTGACTTCCTTAGG + Intergenic
972675393 4:41255675-41255697 GTAAGCAAATTAACTTCTCTAGG + Intergenic
975437332 4:74368007-74368029 GTAAGGTACTTGACTTCACTGGG - Intronic
978510249 4:109509137-109509159 GTAAGCCACATGACTTCTCTGGG + Intronic
978996153 4:115156184-115156206 TTGAGAGACCTGACTTCACTTGG - Intergenic
981487409 4:145301803-145301825 GGTCGCAAACTGACTTCACTGGG - Intergenic
982107110 4:152020769-152020791 GTCAACAACCAGAATTCACTTGG + Intergenic
983259182 4:165436991-165437013 ATAAGCACCTAGACTTCACTGGG - Intronic
984939870 4:184921716-184921738 GTAAGAACCTTGGCTTCACTTGG - Intergenic
989534593 5:42549477-42549499 GAGAGGCACCTGACTTCACTTGG + Intronic
991027169 5:62042456-62042478 TCAATCAACCTGACTTAACTAGG - Intergenic
992895803 5:81244197-81244219 GTAAGGAACTTTACCTCACTTGG - Exonic
992957637 5:81926612-81926634 GTAAGCATCCTGACAACATTAGG + Intergenic
995638170 5:114219536-114219558 AGAAGCAACCTGACTTCAGAGGG - Intergenic
997598090 5:135120596-135120618 TAAAGCAACCTGACCTCCCTAGG - Intronic
999893822 5:156007225-156007247 GTAAGCACCCTCACCACACTGGG + Intronic
1000139132 5:158384322-158384344 GTAAGGGAGATGACTTCACTAGG + Intergenic
1001452927 5:171840071-171840093 TCAAGCAACCTGTCTTCACATGG + Intergenic
1004269096 6:14177931-14177953 GTGAGCAATCTGAGTTCTCTTGG - Intergenic
1006101275 6:31687767-31687789 GTCAGCAACCTGACCTTGCTGGG + Intronic
1008916003 6:56787382-56787404 AACAGCAACTTGACTTCACTTGG + Intronic
1011423467 6:87200483-87200505 CTAAGAAACCTGACTTTAATGGG - Intronic
1012519036 6:100097884-100097906 GTATGTAACTTGACTTCACTGGG - Intergenic
1016738345 6:147505034-147505056 GTAAGGAACTTGACCTCTCTGGG + Intergenic
1017012874 6:150074824-150074846 GCCAGCAACCTGAGTGCACTTGG + Intergenic
1017238586 6:152142655-152142677 GTAATCATACTGACATCACTGGG - Intronic
1018410210 6:163537706-163537728 GGAAGTAACCTGACTGAACTTGG - Intronic
1020670453 7:11101097-11101119 ATAAGCAATGTGACTTCTCTTGG - Intronic
1028526067 7:91788309-91788331 GTAAGCCACTTAACTTCTCTGGG + Intronic
1028674343 7:93441897-93441919 GTAGGCTACCTGCCTTCAGTTGG + Intronic
1031083243 7:117278339-117278361 GTGTGCAACCTGACTTCCCGGGG - Exonic
1034725147 7:153329080-153329102 GTGGGAAACCTGACTCCACTGGG + Intergenic
1036149863 8:6287322-6287344 GTGAGAAACATGTCTTCACTTGG - Intergenic
1036196296 8:6718571-6718593 GCAAGCATCCTGATTTTACTGGG + Intronic
1036615156 8:10382071-10382093 GAAAGCCACTTAACTTCACTGGG - Intronic
1046644472 8:116769911-116769933 GTAAGCGACCTAACTTCATAGGG + Intronic
1047364509 8:124199931-124199953 CTCAGCAACTTGACTTAACTTGG - Intergenic
1048667959 8:136685475-136685497 GGTAGAAACCTAACTTCACTGGG + Intergenic
1048776725 8:137954673-137954695 GTAACCAACATGTCTTCAATGGG + Intergenic
1048776901 8:137956735-137956757 GTAACCAACATGTCTTCAATGGG - Intergenic
1050820314 9:9871547-9871569 GTAAGCAACCTAACCTCCTTGGG + Intronic
1050820334 9:9871624-9871646 GTAAGCAACCTAACCTCCTTGGG + Intronic
1050820371 9:9871778-9871800 GTAAGCAACCTAACCTCCTTAGG + Intronic
1051169774 9:14308874-14308896 GTAACGAAACTGACTGCACTGGG - Intronic
1055449567 9:76418647-76418669 GTAAGCAACTGGACCTCATTTGG - Intergenic
1061451035 9:130667081-130667103 GCAAGCGACCTGACTGCTCTGGG - Intronic
1203761528 EBV:14833-14855 GTAAGTAACCTGACCTCTCCAGG + Intergenic
1203762457 EBV:17905-17927 GTAAGTAACCTGACCTCTCCAGG + Intergenic
1203763386 EBV:20977-20999 GTAAGTAACCTGACCTCTCCAGG + Intergenic
1203764315 EBV:24049-24071 GTAAGTAACCTGACCTCTCCAGG + Intergenic
1203765244 EBV:27121-27143 GTAAGTAACCTGACCTCTCCAGG + Intergenic
1203766173 EBV:30193-30215 GTAAGTAACCTGACCTCTCCAGG + Intergenic
1203767102 EBV:33265-33287 GTAAGTAACCTGACCTCTCCAGG + Intergenic
1187205833 X:17180383-17180405 GCAAGCTACCTGACCTCCCTGGG + Intergenic
1187239978 X:17503524-17503546 GTAAGTTACCTGACCTCTCTGGG - Intronic
1195571135 X:106399758-106399780 GTAACCATCATGACTTCACAGGG + Intergenic
1195647577 X:107249850-107249872 AGAAGCAACCTGACTTCAGAGGG - Intergenic
1198505311 X:137295393-137295415 GTTAGCAAGCTGACTGCATTTGG - Intergenic
1200458875 Y:3428567-3428589 GGATGCAACCTGCCTACACTGGG - Intergenic