ID: 964427634

View in Genome Browser
Species Human (GRCh38)
Location 3:156569837-156569859
Sequence TATGGTTAACAGTAGGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964427634_964427641 20 Left 964427634 3:156569837-156569859 CCATGCCCCTACTGTTAACCATA No data
Right 964427641 3:156569880-156569902 TTCTACATCAGTTACTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964427634 Original CRISPR TATGGTTAACAGTAGGGGCA TGG (reversed) Intergenic
No off target data available for this crispr