ID: 964429440

View in Genome Browser
Species Human (GRCh38)
Location 3:156589368-156589390
Sequence CAACCAGATGGTAAGATGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964429434_964429440 30 Left 964429434 3:156589315-156589337 CCTAAGGGTTGCTTTACCATCAG No data
Right 964429440 3:156589368-156589390 CAACCAGATGGTAAGATGCTAGG No data
964429435_964429440 14 Left 964429435 3:156589331-156589353 CCATCAGCTTTGTCACATTTTCC No data
Right 964429440 3:156589368-156589390 CAACCAGATGGTAAGATGCTAGG No data
964429436_964429440 -7 Left 964429436 3:156589352-156589374 CCTGTACTACCACAACCAACCAG No data
Right 964429440 3:156589368-156589390 CAACCAGATGGTAAGATGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964429440 Original CRISPR CAACCAGATGGTAAGATGCT AGG Intergenic
No off target data available for this crispr