ID: 964435334

View in Genome Browser
Species Human (GRCh38)
Location 3:156645451-156645473
Sequence TCAAAACCCTGGATATGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964435327_964435334 27 Left 964435327 3:156645401-156645423 CCCTTACGAATTACTTGTTCAGA No data
Right 964435334 3:156645451-156645473 TCAAAACCCTGGATATGAGGAGG No data
964435328_964435334 26 Left 964435328 3:156645402-156645424 CCTTACGAATTACTTGTTCAGAA No data
Right 964435334 3:156645451-156645473 TCAAAACCCTGGATATGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964435334 Original CRISPR TCAAAACCCTGGATATGAGG AGG Intergenic
No off target data available for this crispr