ID: 964437275

View in Genome Browser
Species Human (GRCh38)
Location 3:156667399-156667421
Sequence CTCTGTTTTTATAGTAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964437275_964437280 24 Left 964437275 3:156667399-156667421 CCTTCTTTACTATAAAAACAGAG No data
Right 964437280 3:156667446-156667468 GCAAAAGTGGGAACTCTTCATGG No data
964437275_964437278 12 Left 964437275 3:156667399-156667421 CCTTCTTTACTATAAAAACAGAG No data
Right 964437278 3:156667434-156667456 AGTGCCTGAATAGCAAAAGTGGG No data
964437275_964437277 11 Left 964437275 3:156667399-156667421 CCTTCTTTACTATAAAAACAGAG No data
Right 964437277 3:156667433-156667455 CAGTGCCTGAATAGCAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964437275 Original CRISPR CTCTGTTTTTATAGTAAAGA AGG (reversed) Intergenic
No off target data available for this crispr