ID: 964438258

View in Genome Browser
Species Human (GRCh38)
Location 3:156675555-156675577
Sequence ACACCCGGAATTGCAGAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964438248_964438258 14 Left 964438248 3:156675518-156675540 CCTGCTGAGGGGAAGGCGGGGGC 0: 1
1: 0
2: 3
3: 33
4: 426
Right 964438258 3:156675555-156675577 ACACCCGGAATTGCAGAGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 106
964438241_964438258 22 Left 964438241 3:156675510-156675532 CCCAGGCGCCTGCTGAGGGGAAG 0: 1
1: 0
2: 0
3: 18
4: 183
Right 964438258 3:156675555-156675577 ACACCCGGAATTGCAGAGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 106
964438242_964438258 21 Left 964438242 3:156675511-156675533 CCAGGCGCCTGCTGAGGGGAAGG 0: 1
1: 0
2: 0
3: 26
4: 269
Right 964438258 3:156675555-156675577 ACACCCGGAATTGCAGAGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964438258 Original CRISPR ACACCCGGAATTGCAGAGCC GGG Intronic
900121065 1:1048946-1048968 GCGCCCGGAATTCCAGTGCCAGG - Exonic
900136825 1:1121317-1121339 ACCCCCGGCAGTGCTGAGCCTGG + Intergenic
900524601 1:3122362-3122384 GCCCCCGGAATGGCAGATCCCGG + Intronic
901092652 1:6652312-6652334 ACACACGGAGTTTCAGAGGCTGG + Intronic
901551375 1:9997909-9997931 ACCCGCGGGAGTGCAGAGCCTGG + Intronic
904038557 1:27571525-27571547 ACCCCCGAGATTCCAGAGCCTGG - Intronic
907141722 1:52192115-52192137 ACACCCTGATTTGCAGTGGCAGG - Intronic
914900130 1:151707240-151707262 GCAGCCGGAATGGCAGAGACAGG + Exonic
918510943 1:185313919-185313941 ACACCCAGAAGTTCACAGCCCGG + Intronic
918527478 1:185480658-185480680 AAACCCAGAATTGTAGAGCCAGG + Intergenic
1063150368 10:3331456-3331478 ACACCTACAATTGCAGAGCACGG + Intergenic
1064528991 10:16287789-16287811 ACACCTGGAATTCCAGCACCTGG + Intergenic
1064632417 10:17330089-17330111 ACAGCAGCAATTGCAGAGCCAGG - Intronic
1067014598 10:42747949-42747971 TCACCCAGAATTGAAGAGCTAGG - Intergenic
1071519340 10:86319432-86319454 TCAGCCAGGATTGCAGAGCCAGG + Intronic
1080052752 11:27873608-27873630 ACACACAGATTTGCAGAGGCAGG + Intergenic
1084023118 11:66430110-66430132 ACACTCAGAACTGGAGAGCCAGG + Intergenic
1086018637 11:82198530-82198552 ACATCTGGATTTGCAGAGGCAGG + Intergenic
1089870567 11:121668966-121668988 ACACCTGGCATTTCAAAGCCTGG + Intergenic
1091276538 11:134356596-134356618 ACACCTGGTATTGCAGGGGCTGG + Intronic
1091384652 12:85403-85425 ACAGCATGAATTGCAGAGCTGGG - Intronic
1102587778 12:113935134-113935156 ACACAAGGAAATGAAGAGCCTGG + Intronic
1106996319 13:35486588-35486610 ACACAGGTAATTGCAGAGCCAGG + Intronic
1114258973 14:21024383-21024405 ACACTGGGAGTGGCAGAGCCGGG - Exonic
1117213389 14:53525373-53525395 ACAGCCAAAATTGCAGAGCATGG + Intergenic
1121313129 14:92945853-92945875 CCACCCTGAACTGCAGCGCCGGG - Intronic
1122213514 14:100188490-100188512 GCCCCCAGAACTGCAGAGCCCGG + Intergenic
1122670545 14:103368524-103368546 ACAGAGGGCATTGCAGAGCCTGG - Intergenic
1122854871 14:104555189-104555211 ACACCAGGAGCAGCAGAGCCAGG + Intronic
1123932801 15:25179921-25179943 ACACCTCCAAATGCAGAGCCAGG - Intergenic
1127104123 15:55595163-55595185 GCTGCCGGCATTGCAGAGCCTGG + Intergenic
1129443246 15:75597895-75597917 ATACCCAGAATTGCAGTTCCTGG + Intergenic
1129767565 15:78179888-78179910 ACAACTGGAATGGCCGAGCCAGG - Intronic
1132761658 16:1511392-1511414 TCAGCTGGAAATGCAGAGCCAGG + Intronic
1134765343 16:16752404-16752426 ACAGCCTGAATAGCAGAGCTGGG + Intergenic
1134980713 16:18606807-18606829 ACAGCCTGAATAGCAGAGCTGGG - Intergenic
1135993715 16:27232757-27232779 ACAGCCAGAATGGCAGAGCCAGG - Intronic
1135993997 16:27234817-27234839 ACAGCCAGAATGGCAGAGCCAGG - Intronic
1136657393 16:31718263-31718285 ACACCCAAGAATGCAGAGCCAGG + Intronic
1137575704 16:49598666-49598688 ACAGCCAGGATTGCAGGGCCAGG - Intronic
1138345640 16:56318415-56318437 AGACCAGGCATTGCAGGGCCGGG - Intronic
1139825933 16:69757169-69757191 CCACCCAGATTTGCACAGCCTGG - Intergenic
1143012992 17:3876481-3876503 ACACCCGTCCTTGCACAGCCAGG + Intronic
1144847198 17:18226011-18226033 ACACACAGACTGGCAGAGCCAGG - Intronic
1150765516 17:67998838-67998860 ACACCCTGAAATGTAGAGGCAGG + Intergenic
1156977957 18:43247997-43248019 AAACCCAGCCTTGCAGAGCCAGG + Intergenic
1157554139 18:48601879-48601901 ACACCCCAAATCCCAGAGCCTGG - Intronic
1158072555 18:53490593-53490615 ATACTCTGAATTGCAGAGCAGGG + Intronic
1160515323 18:79476293-79476315 CCAGCCGGAATGGCAAAGCCTGG + Intronic
1162131831 19:8530618-8530640 AAACCCGGAACTGCAGCCCCTGG - Intronic
1164076595 19:21824633-21824655 ACACCCAAGAATGCAGAGCCAGG - Intronic
1164140718 19:22459837-22459859 ACACCCGAGAATGCAAAGCCAGG + Intronic
1164271108 19:23672616-23672638 ACACACAGGAATGCAGAGCCAGG - Intronic
1167337510 19:48896062-48896084 AAACCCGGGATTGCGGAGACGGG - Intronic
934659816 2:96137485-96137507 ACACTCAGAAATGCAGAGCCTGG - Intronic
935542778 2:104369296-104369318 ACACTCGGGATTGCAGGGCGAGG + Intergenic
941288199 2:163641495-163641517 AGATCAGGAATGGCAGAGCCAGG + Intronic
942069579 2:172304295-172304317 ACACGCGTAATTACAGTGCCAGG - Intergenic
945650438 2:212551851-212551873 ACACCAGAAATTATAGAGCCGGG + Intergenic
1173387693 20:42604218-42604240 AAACCAGGAAATGCAGAGCGGGG - Intronic
1173812986 20:45967848-45967870 AGAGCCGGACCTGCAGAGCCTGG - Exonic
1173854054 20:46238400-46238422 ACATATGGAATTTCAGAGCCTGG - Intronic
1174014453 20:47476524-47476546 TCACCAGGATTTGGAGAGCCTGG - Intergenic
1174495191 20:50935751-50935773 AGACCAGGAATTACAGAGCAAGG - Intronic
1178921703 21:36743172-36743194 ACCCCAGGAAATGCTGAGCCAGG - Intronic
1180719146 22:17893844-17893866 TCACCTGGAAATGGAGAGCCTGG - Exonic
1181016105 22:20069836-20069858 ACACCAGGAATGGCTGGGCCTGG + Intergenic
953902538 3:46851493-46851515 GCACCTGGAAGTGCAGAGTCTGG + Intergenic
955350190 3:58187949-58187971 ACACAGCGAATGGCAGAGCCAGG - Intergenic
958124059 3:89332695-89332717 AGGCCTGGAATTGCAGGGCCAGG + Intronic
958883801 3:99703336-99703358 AGACGGTGAATTGCAGAGCCAGG + Intronic
958892160 3:99794835-99794857 ATACCCGGAATTGGAAAGCCAGG + Exonic
959539861 3:107525218-107525240 AAGCCCGGAATGGCAGCGCCGGG + Intronic
963430952 3:145201913-145201935 GCACCTGGAATTGCAGAGATGGG + Intergenic
964438258 3:156675555-156675577 ACACCCGGAATTGCAGAGCCGGG + Intronic
968945185 4:3659920-3659942 TCTCCCGGCAGTGCAGAGCCTGG + Intergenic
969306930 4:6331114-6331136 ACACACAAAAATGCAGAGCCGGG - Intronic
972177276 4:36423305-36423327 ACACCTGAAAGTGCAGGGCCAGG + Intergenic
979069176 4:116179274-116179296 ACAACCTGGATTGCACAGCCTGG + Intergenic
982911148 4:161144385-161144407 ACCCCCAGAATGGTAGAGCCAGG + Intergenic
986695555 5:10352067-10352089 ACCCTCGGAGCTGCAGAGCCAGG - Intergenic
988617904 5:32793253-32793275 ACTCCCGGAGTTTCATAGCCTGG + Intergenic
992750817 5:79859023-79859045 AGTCCCGGAATTGCAGCACCTGG - Intergenic
995182411 5:109241202-109241224 ACATCCTGAGTTTCAGAGCCGGG - Intergenic
997408716 5:133673403-133673425 ACAGCCAGGATAGCAGAGCCAGG - Intergenic
1001508870 5:172303339-172303361 AAATCCCGAAATGCAGAGCCGGG + Intergenic
1002080810 5:176736384-176736406 ACACCCGGAATCCCAGAGCTTGG - Intergenic
1002601739 5:180357506-180357528 ACAGCCAGAAGTGGAGAGCCAGG + Intergenic
1005409899 6:25533349-25533371 ACACAGGGAATAGTAGAGCCTGG - Intronic
1006559719 6:34900192-34900214 ACACAGGGGAGTGCAGAGCCTGG + Intronic
1011998921 6:93629179-93629201 ACACCCCAAATTGAACAGCCAGG + Intergenic
1014346798 6:120280642-120280664 ACACACGTAAGTGCAGAGCAGGG - Intergenic
1016802636 6:148182304-148182326 ACACCCGAAATTCAAGAGTCTGG + Intergenic
1017085249 6:150707525-150707547 ACACTGGGAAGTGCACAGCCAGG + Intronic
1020087443 7:5318616-5318638 ACACACGGAATTCCAGATCTAGG + Intronic
1021382846 7:19989103-19989125 ACACCCAAAATTGGAGAGACAGG - Intergenic
1023515173 7:40994571-40994593 AAACCAGGAAATGCAGGGCCTGG + Intergenic
1025791266 7:64689199-64689221 ACACCCAAAAATGCAGAGGCAGG + Intronic
1025866159 7:65383337-65383359 ACACCCAAGAATGCAGAGCCAGG + Intronic
1029273962 7:99393349-99393371 AGTCCCGGAAATGCAGAGCGAGG - Intronic
1029284309 7:99455526-99455548 AAAACAGGAATTGCAGAGCCAGG + Intronic
1031995789 7:128229970-128229992 ACAGCTGGTATAGCAGAGCCTGG + Intergenic
1034063279 7:148112654-148112676 ACACCTGTAATTGCAGTGACTGG - Intronic
1035325156 7:158061245-158061267 ACATCAGTAATTGCAGAGGCGGG - Intronic
1038780441 8:30565019-30565041 CCACCCAGAGCTGCAGAGCCAGG - Intronic
1039135969 8:34323072-34323094 ACACCAGGAATTTGACAGCCAGG + Intergenic
1048514760 8:135096061-135096083 ACACCAGGAAATGCAGAGAACGG + Intergenic
1049042970 8:140126214-140126236 ATACCCCGCATTGGAGAGCCAGG - Intronic
1052019024 9:23504245-23504267 ATACCCGTAATTCCAGAGCTAGG - Intergenic
1054916664 9:70500788-70500810 ACACCCAGAATTCCAGATACAGG - Intergenic
1061570652 9:131475749-131475771 ATACCCGCAATTGCTCAGCCGGG - Exonic
1062307832 9:135919685-135919707 ACACCCGCTCTTGCAGAACCTGG - Intergenic
1186875296 X:13810536-13810558 ATACCCTGAATTGCATGGCCTGG - Intronic
1187239341 X:17498470-17498492 ACACCCTGAATTGCAAAATCAGG - Intronic
1191605189 X:63053984-63054006 ACACCTGGAATTCCAAAGGCAGG - Intergenic
1192458410 X:71296864-71296886 CCACCCAGATTTGCACAGCCTGG + Exonic