ID: 964439280

View in Genome Browser
Species Human (GRCh38)
Location 3:156689194-156689216
Sequence CAAATTACCAGACGTACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964439280_964439284 24 Left 964439280 3:156689194-156689216 CCTGCTGTACGTCTGGTAATTTG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 964439284 3:156689241-156689263 ACCACCCAGACCAGAAACATGGG 0: 1
1: 0
2: 1
3: 23
4: 176
964439280_964439283 23 Left 964439280 3:156689194-156689216 CCTGCTGTACGTCTGGTAATTTG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 964439283 3:156689240-156689262 AACCACCCAGACCAGAAACATGG 0: 1
1: 0
2: 0
3: 22
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964439280 Original CRISPR CAAATTACCAGACGTACAGC AGG (reversed) Intronic
903604197 1:24562946-24562968 CACATTACCAGACAGAGAGCTGG + Intronic
903846367 1:26281883-26281905 CAAATTAGCAGAACTGCAGCTGG - Intronic
904100379 1:28021509-28021531 CAAAGCACCTGACATACAGCAGG + Intronic
908532637 1:65048313-65048335 TAAAATACCAGACACACAGCAGG + Intergenic
909894359 1:81048042-81048064 CAAATTACCACACATTAAGCAGG + Intergenic
913019863 1:114778396-114778418 CATAGTACCTGACATACAGCAGG - Intronic
1074701150 10:116093624-116093646 CAAGGTACAAGAGGTACAGCTGG + Intronic
1075026846 10:118991454-118991476 CAAATTACCAGACCCTCAGAAGG - Intergenic
1080307582 11:30853439-30853461 CAAATTACCAAACCTTCAGAGGG - Intronic
1087635204 11:100694502-100694524 GAAATTACCATTCATACAGCAGG - Intronic
1095350650 12:41207307-41207329 TAGATTCCCAGACATACAGCTGG + Intronic
1098600940 12:72331066-72331088 CAAATTGCCTGGCATACAGCAGG - Intronic
1114032559 14:18589172-18589194 CAAGGTCCCAGATGTACAGCAGG + Intergenic
1114032851 14:18590808-18590830 CAAGGTCCCAGATGTACAGCAGG + Intergenic
1114077339 14:19168197-19168219 CAAGGTCCCAGATGTACAGCAGG + Intergenic
1114077640 14:19169856-19169878 CAAGGTCCCAGATGTACAGCAGG + Intergenic
1115727262 14:36230730-36230752 CAAGTTACCAGATGTAGATCTGG - Intergenic
1202896422 14_GL000194v1_random:13177-13199 CAAGGTCCCAGATGTACAGCAGG - Intergenic
1125827941 15:42691846-42691868 CAAAGTACCAGACATCCAGCTGG - Exonic
1130925413 15:88382056-88382078 CAAATTTCCAGACCCAAAGCAGG + Intergenic
1141260529 16:82449458-82449480 CTAAGTACTAGACATACAGCAGG - Intergenic
1145205172 17:20980976-20980998 CAAATAACCACACGCACAGAAGG + Intergenic
1146389716 17:32410775-32410797 AAAAATTCCAGACGTCCAGCCGG + Intergenic
1146838449 17:36132032-36132054 CAAATATCCAGATGTATAGCTGG - Intergenic
1147319658 17:39638077-39638099 GAAATTACCAGACTTCCGGCTGG - Intronic
1149138008 17:53393593-53393615 CAAATTCCCAGAGGGAAAGCTGG + Intergenic
1151371163 17:73647003-73647025 CCAATTCCCAGAAGTCCAGCAGG + Intergenic
1165578341 19:36840563-36840585 CAAATTCCCAGAAGGAAAGCGGG + Intronic
1167555396 19:50191870-50191892 CAAAATACCAGGGGTACATCTGG + Intronic
1167582089 19:50351048-50351070 CAAATCACAAGACGCTCAGCCGG + Intronic
929252413 2:39773884-39773906 CATATTATCAGAAGTACAGCAGG + Intronic
930699640 2:54446416-54446438 CAAATTAACAGAGGAACAACTGG + Intergenic
938491790 2:131765001-131765023 CAAGGTCCCAGATGTACAGCAGG + Intronic
938495776 2:131797341-131797363 CAAGGTCCCAGATGTACAGCAGG - Intronic
941372163 2:164679276-164679298 CAAATTACCAGCCATCCATCAGG + Intronic
943897816 2:193389812-193389834 CAAAGTACCAAACTTACACCCGG + Intergenic
944530816 2:200666113-200666135 CAAATGAGGAGAAGTACAGCAGG - Intronic
944664157 2:201945757-201945779 CAAAGTACCTGGCATACAGCAGG + Intergenic
947148968 2:227094941-227094963 CAGATTACTAGCCGTAAAGCAGG + Intronic
1169342341 20:4805956-4805978 CAGATAACCAGAAGTACAGCAGG + Intronic
1169423873 20:5481362-5481384 CAAATGAGCAGAAGAACAGCAGG - Intergenic
1170448951 20:16461950-16461972 TAAATTTCCAGATCTACAGCCGG + Intronic
1171497173 20:25563762-25563784 AAAATTACCAGAAATAAAGCAGG + Intronic
1176616110 21:9029173-9029195 CAAGTTCCCAGATGTACAGCAGG - Intergenic
1176709050 21:10134564-10134586 CAAGGTCCCAGATGTACAGCAGG + Intergenic
1180456670 22:15516229-15516251 CAAGGTCCCAGATGTACAGCAGG + Intergenic
1180456967 22:15517865-15517887 CAAGGTCCCAGATGTACAGCAGG + Intergenic
955950570 3:64238793-64238815 AAAATTGCCAAACATACAGCAGG + Intronic
964439280 3:156689194-156689216 CAAATTACCAGACGTACAGCAGG - Intronic
969232901 4:5843999-5844021 AAAATTAGCAGCAGTACAGCTGG - Intronic
971201844 4:24516484-24516506 TAAAATACCACAGGTACAGCCGG + Intergenic
975971763 4:80047825-80047847 GAAATTACCTCAGGTACAGCTGG - Intronic
980514300 4:133833933-133833955 CCAATGACCAGAAGTACAACTGG + Intergenic
982376942 4:154702382-154702404 TAAATTACCCAACGTACATCAGG - Intronic
988554276 5:32222820-32222842 CACATCACCAGACGGACTGCAGG - Intergenic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
1008151306 6:47955286-47955308 TAAATTGACAGAGGTACAGCTGG + Intronic
1008986886 6:57555247-57555269 CAAAGTGCCAGACATACTGCAGG - Intronic
1021548399 7:21842386-21842408 CAAATTTCCTAAAGTACAGCAGG - Intronic
1026284803 7:68953841-68953863 CAAATTCCCAGATGCCCAGCTGG + Intergenic
1026640916 7:72124785-72124807 CAAATGAACTGACCTACAGCAGG + Intronic
1026659347 7:72285882-72285904 CCAATTACCAGACATACAAGGGG + Intronic
1038403054 8:27300056-27300078 CAAATTACCACATGGGCAGCTGG - Intronic
1051038967 9:12783330-12783352 CATATAAACAGACCTACAGCTGG - Intronic
1053646022 9:40120083-40120105 CAAGGTCCCAGATGTACAGCAGG + Intergenic
1053759694 9:41343457-41343479 CAAGGTCCCAGATGTACAGCAGG - Intergenic
1054327034 9:63717980-63718002 CAAGGTCCCAGATGTACAGCAGG + Intergenic
1054538548 9:66255893-66255915 CAAGGTCCCAGATGTACAGCAGG - Intergenic
1062243340 9:135551253-135551275 CAGATGATCAGACGAACAGCTGG - Intergenic
1202793810 9_KI270719v1_random:103534-103556 CAAGGTCCCAGATGTACAGCAGG + Intergenic
1186541989 X:10410227-10410249 CAAAATACCAGACTTCCAGAAGG - Intergenic
1198663023 X:138991350-138991372 TAAATTACCAGACACACAGTAGG - Intronic
1201149493 Y:11087897-11087919 CAAGTTCCCAGATGTACAGCAGG - Intergenic