ID: 964440391

View in Genome Browser
Species Human (GRCh38)
Location 3:156702553-156702575
Sequence TAACACTCATTGGCACATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964440391_964440397 7 Left 964440391 3:156702553-156702575 CCAGTATGTGCCAATGAGTGTTA 0: 1
1: 0
2: 2
3: 5
4: 114
Right 964440397 3:156702583-156702605 TGGCCCTGAACTAGGTCTCAGGG 0: 1
1: 1
2: 0
3: 6
4: 136
964440391_964440394 -1 Left 964440391 3:156702553-156702575 CCAGTATGTGCCAATGAGTGTTA 0: 1
1: 0
2: 2
3: 5
4: 114
Right 964440394 3:156702575-156702597 ATAGCACCTGGCCCTGAACTAGG 0: 1
1: 0
2: 1
3: 31
4: 155
964440391_964440400 12 Left 964440391 3:156702553-156702575 CCAGTATGTGCCAATGAGTGTTA 0: 1
1: 0
2: 2
3: 5
4: 114
Right 964440400 3:156702588-156702610 CTGAACTAGGTCTCAGGGTCAGG 0: 1
1: 0
2: 1
3: 12
4: 142
964440391_964440396 6 Left 964440391 3:156702553-156702575 CCAGTATGTGCCAATGAGTGTTA 0: 1
1: 0
2: 2
3: 5
4: 114
Right 964440396 3:156702582-156702604 CTGGCCCTGAACTAGGTCTCAGG 0: 1
1: 0
2: 1
3: 14
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964440391 Original CRISPR TAACACTCATTGGCACATAC TGG (reversed) Intronic
903655990 1:24949110-24949132 TCACATTCATTCCCACATACTGG + Intronic
923356543 1:233161490-233161512 ACACACTCATTGGCACATACTGG + Intronic
924679975 1:246221225-246221247 GAACGCTCATTGGGACATCCTGG + Intronic
1066218455 10:33311561-33311583 TCACAGTGATCGGCACATACTGG + Intronic
1066278849 10:33895452-33895474 TCACACTCAGTGACACAAACAGG + Intergenic
1068279848 10:54854539-54854561 GAACACTCATTGGGACACTCTGG - Intronic
1073898954 10:108196728-108196750 TAAGACTCGTTGGCACATACTGG + Intergenic
1084931964 11:72563003-72563025 GAACCATCATTGGCCCATACAGG + Intergenic
1087777722 11:102271845-102271867 AAACAGTGATTGGCACTTACTGG - Intergenic
1093281853 12:17204472-17204494 GAACACTCACTGGGACATCCTGG + Intergenic
1096298269 12:50402303-50402325 AAACATTCATTGGAACATTCCGG + Intronic
1098194620 12:67986624-67986646 AAACATTCATTAACACATACTGG + Intergenic
1099288117 12:80740332-80740354 TAGAACACATTGGCACATAGAGG + Intergenic
1100672769 12:96834948-96834970 AAACACTCATTGGGACACCCTGG - Intronic
1101549709 12:105750563-105750585 GAACAATCCTTGGCACATATTGG - Intergenic
1103212320 12:119176037-119176059 TAACAATCACTGGCATTTACGGG - Intergenic
1106540460 13:30685629-30685651 AAACACTCAGTGGCACTTACTGG - Intergenic
1111104311 13:83625939-83625961 GAACTCTCATTGACACTTACTGG - Intergenic
1111713947 13:91853891-91853913 TCTCACTGATTGGAACATACTGG - Intronic
1114424440 14:22610533-22610555 GCACACTCATTGGCACATGGCGG - Intronic
1115272554 14:31570083-31570105 TAACACTCATTGCCAGACACCGG + Intronic
1116188691 14:41634674-41634696 TAGTACACATTGGAACATACAGG - Intronic
1116213933 14:41986064-41986086 TACCTCTCATTCTCACATACAGG + Intergenic
1117361404 14:54978553-54978575 TATCACTCATTTGCCCATGCTGG - Intronic
1121922865 14:97899296-97899318 AAACATTCATTGGCAAATAAAGG + Intergenic
1129377698 15:75144631-75144653 GAACACTCATTGGGACACCCTGG - Intergenic
1146072145 17:29692733-29692755 CAACAGTCACTTGCACATACTGG - Intronic
1147903868 17:43810066-43810088 AAACACTCATTTGGACTTACAGG - Intronic
1148995452 17:51705474-51705496 AAACAGTGCTTGGCACATACAGG + Intronic
1153303030 18:3608290-3608312 TCACTCTCATTGGCCCAGACGGG - Intronic
1164084994 19:21893059-21893081 TAACACTCCTGGACACATCCTGG - Intergenic
1165676028 19:37724428-37724450 TATCACTCTTTGGCCCAGACTGG - Intergenic
1167559988 19:50221129-50221151 TAACACACAGTGTGACATACAGG - Intronic
926541299 2:14183457-14183479 GAACACTCAATGGGACACACTGG + Intergenic
927266842 2:21161777-21161799 GAACACTCATTGGGACACCCTGG - Intergenic
929434434 2:41917043-41917065 TAGCACTTATTGACAGATACAGG - Intergenic
935921348 2:108018958-108018980 TAACATTCCTTGCCACAGACTGG - Intergenic
937142072 2:119610644-119610666 TAGCTCTGATTGGCACATATTGG - Intronic
938581060 2:132646927-132646949 TAGCACTCAATGACACACACTGG + Intronic
939692400 2:145280564-145280586 TAACACTTTTTGGATCATACAGG + Intergenic
940977590 2:159963209-159963231 AAAAACTAATTGTCACATACTGG + Intronic
943719742 2:191191275-191191297 TAACTCTCATTGGCCCAAAATGG - Intergenic
944529617 2:200654565-200654587 GAACACTGAATGGCACAGACAGG + Intronic
947361624 2:229350946-229350968 TAACTCTTATTGGCCCAAACTGG - Intergenic
1169937547 20:10900530-10900552 TAAAATTCATTTGCACAAACTGG + Intergenic
1172741680 20:37173405-37173427 TAGCACTCATGGTCTCATACAGG + Intronic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1173396385 20:42684039-42684061 TAATTCTGATTGGCACCTACTGG - Intronic
1175188778 20:57197684-57197706 TAACATTCATGAGCACAGACAGG + Intronic
1176389838 21:6157774-6157796 TAGCACACATAGGCACACACAGG + Intergenic
1179542180 21:42090291-42090313 AAACACTCATTGACATCTACAGG - Exonic
1179733629 21:43380464-43380486 TAGCACACATAGGCACACACAGG - Intergenic
1184191158 22:42895578-42895600 TACCACCCATCGGCACACACAGG + Intronic
949110940 3:259562-259584 TAACAAGCAATGGGACATACAGG - Intronic
951182243 3:19672096-19672118 GAACACTCATTGGGACACCCTGG - Intergenic
953802094 3:46031962-46031984 GAACACTCATTGGGACACCCTGG + Intergenic
959326724 3:104946183-104946205 CAACACACACTGGCACCTACTGG - Intergenic
963483402 3:145904621-145904643 GAACACTCATTGGGACACCCTGG + Intergenic
964175277 3:153820377-153820399 TAAAAGTCATTGCCACACACAGG + Intergenic
964266216 3:154898478-154898500 TAACACTGTCTGGCACTTACTGG + Intergenic
964440391 3:156702553-156702575 TAACACTCATTGGCACATACTGG - Intronic
966578550 3:181532464-181532486 TATCACTCTTTGGAAAATACTGG - Intergenic
967540584 3:190663207-190663229 TAAAACTCATTGCCAGATATTGG + Intergenic
970375246 4:15450741-15450763 GAACACTGATAGGCACATCCTGG - Intergenic
972275483 4:37553616-37553638 TAGCAATCATTGGCACATCATGG - Intronic
973240330 4:47949528-47949550 TAAGACACATTGGCTCAAACTGG + Intronic
978229857 4:106385548-106385570 AAACACTCATTGGGACACCCTGG - Intergenic
979128299 4:117005705-117005727 TAACATTAATTAACACATACAGG + Intergenic
980288320 4:130810300-130810322 CAAAACTCATTAGCACATAAAGG - Intergenic
983000538 4:162408957-162408979 TAACACTCATCAGGACATCCTGG - Intergenic
986803617 5:11286684-11286706 TAACAGGAGTTGGCACATACAGG + Intronic
986821886 5:11476293-11476315 TAACCCTCATTGGTAATTACAGG - Intronic
986921274 5:12685411-12685433 TAACACTCATGAGCAAATTCAGG - Intergenic
986923560 5:12717648-12717670 GAACACTCATTGGGACACCCTGG + Intergenic
987747560 5:21995629-21995651 TCATAATCATAGGCACATACAGG + Intronic
987999634 5:25331386-25331408 TAACACTCATTGGGACCACCTGG + Intergenic
992693075 5:79259056-79259078 GAACACTCATCGGGACATGCTGG - Intronic
995194954 5:109356368-109356390 AAATACTCATTGGCACATTTTGG - Intronic
999308908 5:150538842-150538864 TGACACTCGTTGTCACACACTGG - Intronic
999887125 5:155936383-155936405 GAACACTCACTGGGACATTCTGG - Intronic
1000073706 5:157764794-157764816 TGACACTAATTGGCCCACACAGG - Intergenic
1002072377 5:176687941-176687963 GAACACTCATTGGGACACCCTGG - Intergenic
1008323031 6:50141478-50141500 TAAGAATCATTGGCATACACTGG + Intergenic
1011561523 6:88622248-88622270 TAACACTCATTTGCCTATATAGG - Intronic
1013241972 6:108254584-108254606 CAACACTGCTTGGCACATAGTGG - Intronic
1013269709 6:108534523-108534545 TGAAACTCAGTGGCACAAACTGG - Intergenic
1016076375 6:139801373-139801395 TAGCACACATGGGCACACACAGG - Intergenic
1017275699 6:152565450-152565472 TAATACTCTTTGGCATTTACTGG + Intronic
1020343418 7:7137343-7137365 TAACGTTTTTTGGCACATACAGG + Intergenic
1020761291 7:12270265-12270287 GAACACTCATTGGGACACCCTGG + Intergenic
1022255270 7:28650096-28650118 TAACAGTGATTAGCAGATACTGG - Intronic
1022748256 7:33195194-33195216 TCACAGTCTTTGGCACATAGTGG + Intronic
1023286564 7:38627208-38627230 TAACTCTCAGTGGCCCAAACTGG - Intronic
1028439345 7:90840960-90840982 ACACACTCATATGCACATACAGG + Intronic
1028816838 7:95156624-95156646 GAACTCTCATTGGAACATCCTGG - Intronic
1029868608 7:103663497-103663519 TAGCACAAATTGGCACAAACTGG + Intronic
1034481299 7:151321918-151321940 GAACACTCATTGGGACACCCTGG + Intergenic
1036067091 8:5392988-5393010 TAACACTAAATGACAAATACAGG + Intergenic
1036261469 8:7244095-7244117 TAAAAATCATTTGAACATACAGG + Intergenic
1036313509 8:7702639-7702661 TAAAAATCATTTGAACATACAGG + Intergenic
1036925690 8:12903018-12903040 TAACACTCAGTGGTTAATACTGG + Intergenic
1037777824 8:21847424-21847446 GAACACTCATTGGGACACTCTGG - Intergenic
1039008814 8:33070598-33070620 GAACACTCATTGGAATAAACAGG + Intergenic
1039336188 8:36592324-36592346 TATCTCTCACTGGCACAGACGGG - Intergenic
1041721998 8:60984214-60984236 TAATTCTCATTAGCAAATACTGG - Intergenic
1043087124 8:75849161-75849183 AAACACTCATTGGGACACCCTGG - Intergenic
1043507821 8:80920150-80920172 TAACACTCCTTGGAAACTACTGG + Intergenic
1046172858 8:110534368-110534390 ACACAATCATTGGCATATACAGG + Intergenic
1048369527 8:133765645-133765667 TAGGACTCACTGGGACATACAGG - Intergenic
1048671526 8:136728480-136728502 TACCAATTATTGGCAAATACTGG - Intergenic
1049519717 8:143081850-143081872 TAACACTCTATGACACATAAGGG + Intronic
1050396275 9:5200316-5200338 TACCAGTCATTAGCACAAACGGG + Intergenic
1057713229 9:97466129-97466151 TTGCACTCAGTGACACATACAGG - Intronic
1062123057 9:134844275-134844297 TGACAGTCATTGGCACATGCTGG - Exonic
1185883702 X:3762922-3762944 TCACACTCATCTGCAAATACAGG - Intergenic
1190294283 X:49015655-49015677 TAACACTCATTGCCTCATAGGGG - Intergenic
1195126558 X:101814253-101814275 GAACACTCATTGGAACACCCTGG + Intergenic
1199187953 X:144939103-144939125 GAACACTCATTGGGACACCCTGG - Intergenic
1199301979 X:146223413-146223435 TAAAAGTCATTGGCACATTTTGG - Intergenic
1199702580 X:150393986-150394008 TAAAAGTCATTGCCACATCCGGG + Intronic
1200781699 Y:7222347-7222369 TCACACTCATTTGCAAATACAGG + Intergenic
1201456778 Y:14176898-14176920 CAACACACACTGGCACGTACTGG + Intergenic