ID: 964442169

View in Genome Browser
Species Human (GRCh38)
Location 3:156723243-156723265
Sequence CACTGGGAAAGGCCTACACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964442164_964442169 -3 Left 964442164 3:156723223-156723245 CCTGAGTTTGGAAAGGCCTGCAC No data
Right 964442169 3:156723243-156723265 CACTGGGAAAGGCCTACACTTGG No data
964442160_964442169 24 Left 964442160 3:156723196-156723218 CCAGGTTCTGTCAGCACACATAA No data
Right 964442169 3:156723243-156723265 CACTGGGAAAGGCCTACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964442169 Original CRISPR CACTGGGAAAGGCCTACACT TGG Intergenic
No off target data available for this crispr