ID: 964442740

View in Genome Browser
Species Human (GRCh38)
Location 3:156728775-156728797
Sequence CATGGGCAGCCAGCGGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964442733_964442740 5 Left 964442733 3:156728747-156728769 CCTGGAAGGCATTTATTTTCTGA No data
Right 964442740 3:156728775-156728797 CATGGGCAGCCAGCGGCTGTGGG No data
964442732_964442740 6 Left 964442732 3:156728746-156728768 CCCTGGAAGGCATTTATTTTCTG No data
Right 964442740 3:156728775-156728797 CATGGGCAGCCAGCGGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964442740 Original CRISPR CATGGGCAGCCAGCGGCTGT GGG Intergenic
No off target data available for this crispr