ID: 964444673

View in Genome Browser
Species Human (GRCh38)
Location 3:156746262-156746284
Sequence CCCCACTGCTTGCCAGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964444673_964444677 -6 Left 964444673 3:156746262-156746284 CCTGTTTCTGGCAAGCAGTGGGG No data
Right 964444677 3:156746279-156746301 GTGGGGGTAGGTGCTGCTTGAGG No data
964444673_964444678 -5 Left 964444673 3:156746262-156746284 CCTGTTTCTGGCAAGCAGTGGGG No data
Right 964444678 3:156746280-156746302 TGGGGGTAGGTGCTGCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964444673 Original CRISPR CCCCACTGCTTGCCAGAAAC AGG (reversed) Intergenic
No off target data available for this crispr