ID: 964444774

View in Genome Browser
Species Human (GRCh38)
Location 3:156747540-156747562
Sequence ACAAGGAAATCCAACACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 224}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964444774_964444781 30 Left 964444774 3:156747540-156747562 CCCTCAGTGTTGGATTTCCTTGT 0: 1
1: 0
2: 1
3: 15
4: 224
Right 964444781 3:156747593-156747615 CCGAGGCATCATGTTTAGGCAGG 0: 1
1: 0
2: 0
3: 2
4: 43
964444774_964444779 26 Left 964444774 3:156747540-156747562 CCCTCAGTGTTGGATTTCCTTGT 0: 1
1: 0
2: 1
3: 15
4: 224
Right 964444779 3:156747589-156747611 ATGTCCGAGGCATCATGTTTAGG 0: 1
1: 0
2: 0
3: 7
4: 68
964444774_964444778 13 Left 964444774 3:156747540-156747562 CCCTCAGTGTTGGATTTCCTTGT 0: 1
1: 0
2: 1
3: 15
4: 224
Right 964444778 3:156747576-156747598 AGACAGAAGCAGAATGTCCGAGG 0: 1
1: 0
2: 2
3: 10
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964444774 Original CRISPR ACAAGGAAATCCAACACTGA GGG (reversed) Intergenic
900713166 1:4127870-4127892 ACTACGAAAACCCACACTGAAGG - Intergenic
902116726 1:14127488-14127510 GCCAGGAAATCCAACGCTAATGG + Intergenic
903209296 1:21807521-21807543 ACAATGAATTACAAAACTGAAGG - Intergenic
905004831 1:34701135-34701157 AGAGGGAAGTCCAATACTGAAGG - Intergenic
908828476 1:68156217-68156239 ACATAGAAACCCAACATTGATGG - Intronic
909955353 1:81772273-81772295 ACAATGAAATTAAACACTAAAGG - Intronic
911567582 1:99481631-99481653 AGAAGGAAATCAAACACTTCAGG + Intergenic
912566919 1:110594085-110594107 AGAAGGAACTCCAAGGCTGATGG - Intronic
913129298 1:115825375-115825397 ACAAGGAAATCTCACAGGGAGGG - Intergenic
913202806 1:116509626-116509648 ACAAGGAAAGACCTCACTGAGGG - Intergenic
915062734 1:153199668-153199690 AGAAGGAAATCCAACATTCAAGG + Intergenic
915263019 1:154692929-154692951 ACTAGGAAGTCCAAGATTGAGGG - Intergenic
918421325 1:184366751-184366773 CCAAGGAATTCCATCACTGTTGG + Intergenic
919556310 1:199058403-199058425 ACAAGCAAAGCCAACAGTGAAGG + Intergenic
921641304 1:217558396-217558418 ACAATGGAATCAAACACGGAAGG + Intronic
921768292 1:219000732-219000754 AAAAGAAAATCCCACAATGATGG - Intergenic
923303468 1:232665079-232665101 ACAAGCAAATCAAAGAATGAAGG - Intergenic
923365466 1:233256352-233256374 AGAAGAAACTCCAACACAGATGG + Intronic
923667945 1:236015193-236015215 ACAAGGAATTCCAAGAGAGATGG + Intronic
1065233975 10:23628079-23628101 ACAAGGACATACAAAATTGATGG + Intergenic
1065299595 10:24309212-24309234 ACAATGAAATCCAGTTCTGAGGG + Intronic
1067035606 10:42914133-42914155 AGAAGGAAATTGAACACAGAAGG + Intergenic
1068989940 10:63139833-63139855 ACAAGGTAATACAACAATGTGGG + Intronic
1073040504 10:100601242-100601264 TCTAGGAAGTCCAAGACTGAGGG + Intergenic
1080299653 11:30769677-30769699 TCAAGGAAATCTCAAACTGAGGG + Intergenic
1080426292 11:32157734-32157756 ACTAGGAGATCCACCTCTGAGGG - Intergenic
1081810457 11:45911224-45911246 CCACCGACATCCAACACTGAAGG + Intronic
1084075950 11:66776462-66776484 ACAAGGAAATTAAACAAGGAAGG + Intronic
1084234397 11:67777429-67777451 TCTAGGAAATCCAGCATTGAAGG + Intergenic
1084376265 11:68779993-68780015 ACTAGGAAATCCAGCACATAAGG + Intronic
1085060730 11:73444143-73444165 ACAAGGATATCCTATACTGCAGG + Intronic
1085701235 11:78747645-78747667 CCAAGCAAATCCCACAGTGAGGG - Intronic
1090530832 11:127590202-127590224 ACAAGGGATTCAAACACTGAAGG - Intergenic
1091569937 12:1676097-1676119 ACAATTAAATCCAACAATAAAGG - Intergenic
1094338031 12:29382682-29382704 ACTGGGAAATCCAACTCTCATGG - Intergenic
1094465881 12:30754154-30754176 ACAAGGCAATCCATCACTACTGG + Exonic
1097174288 12:57133914-57133936 ACAGCGAAGTCCAACCCTGAAGG - Intronic
1097956224 12:65488029-65488051 GCCAGGAAATCCAAGATTGAGGG - Intronic
1098078891 12:66762256-66762278 ACAAGGAGATTCTAGACTGAAGG + Intronic
1098234242 12:68403193-68403215 AGAAGGAAACTCAACAATGATGG + Intergenic
1099230447 12:80017612-80017634 ACAAAGAAATCAAACACATAGGG - Intergenic
1099362133 12:81717403-81717425 TGCAGGAAATCCAACACTGGTGG + Intronic
1101720886 12:107349836-107349858 ACAGGCTAATCAAACACTGAAGG + Intronic
1101781311 12:107840283-107840305 ACAGGGAAAGGCAACATTGAGGG - Intergenic
1103312942 12:120026601-120026623 ACAAGGAAATACACTAATGATGG + Intronic
1104422298 12:128646197-128646219 ACACTCACATCCAACACTGATGG - Intronic
1104422301 12:128646232-128646254 ACACTCAAATCCAACGCTGACGG - Intronic
1104422309 12:128646337-128646359 ACACTCACATCCAACACTGATGG - Intronic
1104422315 12:128646407-128646429 ACACTCACATCCAACACTGATGG - Intronic
1104422318 12:128646442-128646464 ACACTCACATCCAACACTGATGG - Intronic
1104422376 12:128647124-128647146 ACACTCACATCCAACACTGATGG - Intronic
1104422388 12:128647260-128647282 ACACTCACATCCAACACTGATGG - Intronic
1104422426 12:128647709-128647731 ACACTCACATCCAACACTGATGG - Intronic
1104422469 12:128648230-128648252 ACACCCACATCCAACACTGATGG - Intronic
1104422484 12:128648403-128648425 ACACTCACATCCAACACTGATGG - Intronic
1105051559 12:133057082-133057104 TTAAGGAAATCAAACAGTGAAGG + Exonic
1105588602 13:21769112-21769134 ACAAAGCAATCCAACAATAAAGG - Intergenic
1106824859 13:33509500-33509522 CCTAGGAATTCCACCACTGAGGG + Intergenic
1107972099 13:45653292-45653314 ACAAACAAATGCAACACTGTTGG - Intergenic
1107979773 13:45723522-45723544 ACAAGCAAAGAAAACACTGAAGG - Intergenic
1108034145 13:46270476-46270498 TCAAGAAAAGCCATCACTGAAGG + Intronic
1108047574 13:46397685-46397707 ATAATGAAATCCAAGTCTGAAGG - Intronic
1108318951 13:49268225-49268247 ACAAGGAATCCCAAAACTGCTGG - Intronic
1110461962 13:75755055-75755077 ATGAGGCATTCCAACACTGAAGG + Intronic
1112133263 13:96547373-96547395 ATAAGGAAATACTAGACTGAGGG - Intronic
1114304303 14:21407335-21407357 ACAATGAAATCCACAACTGCTGG + Intronic
1114374641 14:22131122-22131144 TCAAGGAACCCAAACACTGATGG - Intergenic
1114721798 14:24890497-24890519 AAAATTAATTCCAACACTGAAGG + Intronic
1115406922 14:33027530-33027552 ACAAGAAAATTCAAGACAGAGGG - Intronic
1115733228 14:36295055-36295077 AAAAGGAAATGGAACATTGATGG - Intergenic
1116114210 14:40627578-40627600 AAATGCAAATCCAACACTAAGGG + Intergenic
1116603580 14:46960338-46960360 ACAAGGAAAGTCATCACAGATGG - Intronic
1116706049 14:48302449-48302471 AGAAAGAAAACCAACACTGCAGG - Intergenic
1117549453 14:56818870-56818892 ACAATGAAAGCCATCACTTAAGG + Intergenic
1117938323 14:60933710-60933732 ACAAGGAAAACAAACAATTATGG - Intronic
1120643742 14:87046986-87047008 AAGAGGAAATTCAACACTGGAGG + Intergenic
1121303596 14:92890763-92890785 ACAGAGAATTCCAACTCTGAGGG - Intergenic
1123968440 15:25481637-25481659 AAAAGGAAAGCCAAAACTGCAGG - Intergenic
1125369662 15:38959387-38959409 GCATGGAAATCATACACTGAAGG - Intergenic
1126509157 15:49447583-49447605 CCAAGCAAATACACCACTGATGG - Intronic
1128146750 15:65336224-65336246 ATAAGGAAATCCTGCACTGTTGG + Intronic
1128167412 15:65478052-65478074 AGAAGGAAAACCACCACTTAAGG + Intronic
1129256771 15:74338266-74338288 TCAAGGAAATGCAGCACTAAGGG - Intronic
1131612528 15:93980068-93980090 AGAATGAATTGCAACACTGATGG - Intergenic
1131984277 15:98025645-98025667 ACAAGTAAATACAACGCAGAGGG + Intergenic
1133454897 16:5933478-5933500 ACAAGGAGATTCAACCCTGACGG - Intergenic
1133863295 16:9617115-9617137 CCAAGGAAAACCAACATTAAGGG + Intergenic
1136508710 16:30722831-30722853 GCAAGGGAAAACAACACTGAGGG - Intronic
1137247617 16:46718495-46718517 ACCAGGAAGACCAGCACTGAGGG + Intronic
1137703159 16:50512743-50512765 TCTAGGAAATCCAAGATTGAGGG - Intergenic
1137939256 16:52666931-52666953 ACAATGAAATCCTAAACTAATGG - Intergenic
1138841915 16:60520252-60520274 ACAAAGATATCCCACACTAATGG + Intergenic
1139927383 16:70497395-70497417 AAAGGCAAAGCCAACACTGAGGG + Intronic
1140708248 16:77651530-77651552 AGAAGGAAATCCTACCATGATGG + Intergenic
1140966388 16:79970184-79970206 AAATGTAAATCTAACACTGATGG - Intergenic
1141026495 16:80553745-80553767 ACAAGGAAATACACTAGTGAAGG + Intergenic
1142730435 17:1851220-1851242 AGATGGAAATACAACACGGACGG - Intronic
1142800268 17:2340572-2340594 AAAAAGAAATCAAACACTGAAGG - Intronic
1143511960 17:7401365-7401387 ACAAGGAAGATCAACCCTGAGGG - Intronic
1145102058 17:20085756-20085778 ATAAGGAAATCCAGAACTCACGG + Intronic
1147835385 17:43326959-43326981 AAAAGGAATTCCAAAAGTGACGG - Intergenic
1149645119 17:58235268-58235290 GAAAGGAAAGACAACACTGAGGG + Intronic
1151482426 17:74378246-74378268 ACTGGGAAACCCAACACAGAGGG - Intergenic
1155331087 18:24716840-24716862 ACAATGAAAGACACCACTGATGG - Intergenic
1157099485 18:44716356-44716378 AAAATTAAATCCACCACTGACGG + Intronic
1159060662 18:63510814-63510836 ACAAGGATATCCTACAGAGATGG + Intergenic
1161438488 19:4278163-4278185 ATAAGGAAAACCAAGACTCAGGG + Intergenic
1161794525 19:6378757-6378779 ACAAGAAAATCTATCACTAAGGG + Intronic
1162219945 19:9167833-9167855 ACAAGGAAATCCTACAAAGAAGG + Intergenic
1166675550 19:44738680-44738702 TCAAGGAACTCTTACACTGATGG + Intergenic
926381263 2:12292424-12292446 AGAATGCAATCCAACACTGTTGG - Intergenic
929408009 2:41665488-41665510 ACTAGGAAATCCAAGACTGAGGG + Intergenic
930154071 2:48087728-48087750 GCTGGGAAATCCAAGACTGAAGG + Intergenic
930351388 2:50260019-50260041 AGAAGGAAATCCATCACTACTGG + Intronic
930468521 2:51783764-51783786 ACAAGGATATAAAATACTGATGG - Intergenic
931954764 2:67409711-67409733 AAAAGAAAATCAAGCACTGATGG - Intronic
935620588 2:105126166-105126188 ACAAGGAGATTCCCCACTGAGGG - Intergenic
935635755 2:105248616-105248638 ACAAAGACAGCCAACACTAAGGG + Intergenic
939690928 2:145259267-145259289 ACAAAGAAAATCTACACTGAAGG + Intergenic
939734064 2:145821593-145821615 AAAACTAAATCCAAAACTGATGG - Intergenic
940584176 2:155623222-155623244 ACAACAAAATCCTACGCTGATGG + Intergenic
942597196 2:177602338-177602360 AAGAGGAAGTACAACACTGAAGG + Intergenic
942851605 2:180494407-180494429 ACCAGGAACACCAACACAGAAGG - Intergenic
942963118 2:181856392-181856414 GCAAGCAAATTCAACTCTGAGGG + Intergenic
944380046 2:199098057-199098079 ACAAGGAAATCCAAAAATACTGG + Intergenic
944858542 2:203792007-203792029 ACCAGTAAATCCAACTCTAAGGG - Intergenic
948720771 2:239898765-239898787 ACAACGAAGTCCTACACAGATGG + Intronic
948969962 2:241417864-241417886 ATCAGGAAAACCAACAATGAAGG - Intronic
1169746194 20:8945543-8945565 ACTAGGAAATTCAACCCTGAAGG + Intronic
1169764738 20:9136810-9136832 AACAGAATATCCAACACTGATGG - Intronic
1170578178 20:17680492-17680514 CCAAGGAAATGAAACTCTGAGGG - Intronic
1171988711 20:31678962-31678984 AGAAGGAAATGCAACACCGTGGG - Intronic
1173986441 20:47265317-47265339 ACAAGGACGTCCAACCCTAAAGG + Intronic
1178419983 21:32435538-32435560 TCTAGGAAATCCAGCCCTGAAGG - Intronic
1179027678 21:37693444-37693466 ACCAGGAAATCAAACCCTCAAGG + Intronic
950949776 3:16986202-16986224 ACAAAGAAACCCAATACTCAGGG - Intronic
952219381 3:31309362-31309384 AATAGGGAATCCAACACTGGAGG - Intergenic
954005052 3:47583979-47584001 ACAAGGAGATCCAACAAAGGAGG + Intergenic
955575648 3:60359862-60359884 TCAATAAAATCCAACAATGATGG + Intronic
956158353 3:66321910-66321932 GCTAGGAAGTCCAAGACTGAGGG + Intronic
958092743 3:88897579-88897601 ACAAGGAAATTCATCATTAAGGG + Intergenic
960505667 3:118490325-118490347 ACAAAGAAATGAAAAACTGAGGG + Intergenic
960543420 3:118885429-118885451 TCAAGAAGATCCAACTCTGAGGG - Intergenic
961884024 3:130083974-130083996 TCTAGGAAATCCAGCATTGAAGG + Intronic
962811746 3:138964497-138964519 AGAAGGAAATTGAACTCTGAAGG - Intergenic
964395501 3:156241488-156241510 ACAAAGGAATCCAACTCAGAAGG - Intronic
964444774 3:156747540-156747562 ACAAGGAAATCCAACACTGAGGG - Intergenic
964658516 3:159094563-159094585 ACAAAGAAAGACAACATTGAAGG - Intronic
964919557 3:161879962-161879984 TCAAGGCAATCCACCATTGATGG - Intergenic
965987371 3:174771776-174771798 ACAAGGTAATCAAACTCTGATGG + Intronic
966342890 3:178945215-178945237 AGAAGGAAATGCAACACAGGTGG - Intergenic
967056247 3:185831214-185831236 ACAAGGAAATCATTAACTGAAGG + Intergenic
969060502 4:4430312-4430334 AGAAAGAAATACAACACTGTTGG - Intronic
969820752 4:9718317-9718339 TCTAGGAAATCCAGCATTGAAGG - Intergenic
972029431 4:34434718-34434740 ACAAAGAAGTCCAACAGTGCTGG - Intergenic
972082540 4:35171709-35171731 GCAAGCAAGTCCAAGACTGAGGG - Intergenic
973053574 4:45626723-45626745 ACAAGGAATTCAAAATCTGAGGG - Intergenic
973305755 4:48647452-48647474 TCAAGAAAATCCAACATAGATGG - Intronic
974247107 4:59333912-59333934 GCAGGAAAGTCCAACACTGAGGG - Intergenic
976379273 4:84380635-84380657 ACCAGCAATTCCACCACTGATGG + Intergenic
976477207 4:85497938-85497960 AGAAGGAAATTGAACACCGAGGG - Intronic
977323200 4:95546216-95546238 ACAAGGAAATCATACCTTGAGGG + Intronic
979043568 4:115833737-115833759 CAAAGAAAATCCAATACTGAAGG - Intergenic
979392492 4:120143087-120143109 AAAGGAAAACCCAACACTGAAGG + Intergenic
979478135 4:121182560-121182582 ACAAGGAAGTACATGACTGACGG + Intronic
979721248 4:123902957-123902979 ACTATTAAATCCAACATTGATGG + Intergenic
979731915 4:124034190-124034212 ACAAGTAAATGCTACCCTGAAGG - Intergenic
981426338 4:144607866-144607888 ACATGGAAAGAGAACACTGAGGG + Intergenic
981762392 4:148208687-148208709 ACAAGGAAGTCCAGCCCAGAAGG - Intronic
982764719 4:159332606-159332628 AAAAGTAAAGCCAACACTGTGGG + Exonic
983687211 4:170424623-170424645 AAAAGAAAATCCTACACTGTTGG - Intergenic
987377964 5:17254843-17254865 ATAAGGATATCCAACATAGATGG - Intronic
988838152 5:35054181-35054203 AAATGGAAATACTACACTGATGG + Intronic
990294414 5:54386061-54386083 AACAGGAAATCCAACCCTGAGGG + Intergenic
991426947 5:66501933-66501955 ACAAGGAAATTGAACCCAGAAGG - Intergenic
993517256 5:88853215-88853237 ACAAAAAAATCCAAAACAGATGG - Intronic
994358682 5:98825308-98825330 ACCAGGGAATCCAACACAGGAGG + Intergenic
997025665 5:130058125-130058147 AGAAGAAAATCAGACACTGAAGG - Intronic
1000688737 5:164287855-164287877 ACAAGAAAATCAAAGACTGAGGG - Intergenic
1001129369 5:169051162-169051184 AAAAGGAAATCAAACATTCAAGG + Intronic
1001412151 5:171519495-171519517 ACGAGGAAGTCCAAGACAGAGGG + Intergenic
1002876238 6:1212507-1212529 ACATGGAAAACTAACACTAAAGG + Intergenic
1003332794 6:5143688-5143710 ACAAGGCAATACAGCTCTGATGG + Intronic
1005559773 6:27026561-27026583 ACAGGGAATACCAACACTAAAGG - Intergenic
1005731584 6:28702209-28702231 ACAAGAAATTGCAACAGTGATGG - Intergenic
1005813458 6:29532720-29532742 ACATGGAAAGTCAATACTGATGG + Intergenic
1005906938 6:30269783-30269805 ACAAGAAAATACAACTCAGAAGG + Intergenic
1008214225 6:48765978-48766000 AGAAGAAAATACAAGACTGAAGG + Intergenic
1008843131 6:55928625-55928647 ACAAGGAAAAAGAACACTGGGGG - Intergenic
1009343076 6:62583021-62583043 AGAAAGAAATCCAACATGGAAGG + Intergenic
1011025334 6:82862647-82862669 AACAAGAATTCCAACACTGAAGG + Intergenic
1011996703 6:93598719-93598741 ACAAAGAAATGAAAAACTGAAGG + Intergenic
1012076453 6:94692336-94692358 ACAAGGATATCCAAAACTGTAGG + Intergenic
1015829318 6:137350845-137350867 AAAAAGAAATCTAACATTGATGG - Intergenic
1015841897 6:137486384-137486406 AGAAAGAAATTCAACACAGAAGG + Intergenic
1016309660 6:142720056-142720078 CAAAGGTAATCAAACACTGATGG - Intergenic
1017862661 6:158413468-158413490 ACATGGAATCACAACACTGAAGG - Intronic
1017890268 6:158632021-158632043 TAAAGGAAAACCAAAACTGAGGG + Exonic
1018364315 6:163102278-163102300 ACAGTAAAATCCAGCACTGATGG + Intronic
1019927066 7:4200229-4200251 ACCATGAAATCCAACATTCATGG + Intronic
1019966860 7:4506466-4506488 CCAGGGAGATCCAACACTGCTGG + Intergenic
1023454970 7:40328805-40328827 ACAATGATTTCCAGCACTGAAGG - Intronic
1028326913 7:89539619-89539641 ACAAGGAAAGCCAGCACAGGTGG + Intergenic
1028676743 7:93473011-93473033 ACAAAGAAGTCCAAAACTAAGGG + Intronic
1028713675 7:93939766-93939788 AGCAGCAACTCCAACACTGAAGG - Intergenic
1031304448 7:120108560-120108582 TCATGGAACTGCAACACTGATGG - Intergenic
1032553888 7:132811795-132811817 CCAAGGAACTCCAACATTGAGGG - Intronic
1035908521 8:3539643-3539665 ACAAGGTCACCCAACAGTGAGGG - Intronic
1036794102 8:11742999-11743021 CCAAGGAGATACAACACAGAAGG - Intronic
1037193575 8:16157854-16157876 AAGAAGAAAGCCAACACTGAGGG - Intronic
1037199210 8:16230387-16230409 ATAATGAAATCCAATATTGATGG - Intronic
1038914261 8:32002511-32002533 AAAAAAAAATCCCACACTGATGG - Intronic
1038942896 8:32325127-32325149 AGAAAGAAATTCAACACTTAAGG + Intronic
1042606876 8:70554539-70554561 GCTAGGAAGTCCAAAACTGAAGG + Intergenic
1043094508 8:75949403-75949425 ACCAGGAAATCCAACATTGGAGG + Intergenic
1046567556 8:115920385-115920407 GCAAGGAAAGGCCACACTGAGGG - Intergenic
1048072096 8:131031728-131031750 ACCAGGAATTCCAAGACTGAGGG - Intronic
1050778366 9:9297677-9297699 ATAATAAAATCCAACATTGATGG + Intronic
1052423665 9:28275826-28275848 CCAAGGAAATAAAACAATGAAGG + Intronic
1055889203 9:81104987-81105009 ACATGGAACTCCAAAACTGTGGG + Intergenic
1058632111 9:107000020-107000042 ACAAGGATATCGAACACAGGAGG + Intronic
1060378882 9:123145759-123145781 AAAAAGAAAACCAACAATGAGGG - Intronic
1062608994 9:137364650-137364672 GCAATGAAATCTAACACTGCAGG + Intronic
1187531890 X:20104748-20104770 ACAAGGAAAGCTTCCACTGAAGG + Intronic
1187609478 X:20926219-20926241 AAAAGGAAGACCAACACAGAAGG + Intergenic
1188405944 X:29809814-29809836 AGAAGGAAAACTAACACAGAGGG - Intronic
1188885106 X:35539696-35539718 ATAAGAAAATCCAAAAATGAAGG + Intergenic
1189894713 X:45642872-45642894 GCTAGGAAGTCCAAGACTGAGGG - Intergenic
1193441597 X:81546273-81546295 ACAAGAAAATGCAACCCTCATGG + Intergenic
1194032965 X:88838141-88838163 ATAAGTAAATCTAACACTGTTGG - Intergenic
1195087955 X:101430652-101430674 AGAAGCAAATCAAACACTGATGG + Intronic
1195607227 X:106820842-106820864 ACAAGAAAATAAAACACTTAAGG - Intronic
1196338233 X:114564570-114564592 GCTAGGAAGTCCAAGACTGAGGG + Intergenic
1197457755 X:126699124-126699146 ACAAGGAAAACAAAAACTCATGG + Intergenic
1198038694 X:132827304-132827326 AGATAGAACTCCAACACTGAAGG + Intronic
1198209947 X:134507361-134507383 ACAAGGCAGGGCAACACTGAAGG - Intronic
1199014624 X:142800144-142800166 ACAAGGATATCAACAACTGAAGG - Intergenic
1200704975 Y:6434940-6434962 AGAAGGAAATCCCAAAATGATGG + Intergenic
1201029136 Y:9729768-9729790 AGAAGGAAATCCCAAAATGATGG - Intergenic
1202179170 Y:22124873-22124895 AGAAGGAAATCCCAAAATGATGG + Intergenic
1202212191 Y:22461521-22461543 AGAAGGAAATCCCAAAATGATGG - Intergenic