ID: 964448681

View in Genome Browser
Species Human (GRCh38)
Location 3:156788013-156788035
Sequence AACCACATGGAGCAGATAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964448681_964448686 -7 Left 964448681 3:156788013-156788035 CCATTTATCTGCTCCATGTGGTT No data
Right 964448686 3:156788029-156788051 TGTGGTTGGGAAAAGGACCTAGG No data
964448681_964448690 12 Left 964448681 3:156788013-156788035 CCATTTATCTGCTCCATGTGGTT No data
Right 964448690 3:156788048-156788070 TAGGAAAATAACATTTTGTGGGG No data
964448681_964448689 11 Left 964448681 3:156788013-156788035 CCATTTATCTGCTCCATGTGGTT No data
Right 964448689 3:156788047-156788069 CTAGGAAAATAACATTTTGTGGG No data
964448681_964448688 10 Left 964448681 3:156788013-156788035 CCATTTATCTGCTCCATGTGGTT No data
Right 964448688 3:156788046-156788068 CCTAGGAAAATAACATTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964448681 Original CRISPR AACCACATGGAGCAGATAAA TGG (reversed) Intergenic
No off target data available for this crispr