ID: 964450971

View in Genome Browser
Species Human (GRCh38)
Location 3:156812893-156812915
Sequence CCAGTTGCAATGCAAGACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964450968_964450971 17 Left 964450968 3:156812853-156812875 CCAAAAGGTTGAGCCACGCTGTC No data
Right 964450971 3:156812893-156812915 CCAGTTGCAATGCAAGACTGAGG No data
964450969_964450971 4 Left 964450969 3:156812866-156812888 CCACGCTGTCTGACTGTATCATG No data
Right 964450971 3:156812893-156812915 CCAGTTGCAATGCAAGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964450971 Original CRISPR CCAGTTGCAATGCAAGACTG AGG Intergenic
No off target data available for this crispr