ID: 964451009

View in Genome Browser
Species Human (GRCh38)
Location 3:156813299-156813321
Sequence CTGTGTTGGCAGATGAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964450999_964451009 28 Left 964450999 3:156813248-156813270 CCCATGGTGCTTTTATTCAAGAT No data
Right 964451009 3:156813299-156813321 CTGTGTTGGCAGATGAAGCTAGG No data
964451000_964451009 27 Left 964451000 3:156813249-156813271 CCATGGTGCTTTTATTCAAGATG No data
Right 964451009 3:156813299-156813321 CTGTGTTGGCAGATGAAGCTAGG No data
964450998_964451009 29 Left 964450998 3:156813247-156813269 CCCCATGGTGCTTTTATTCAAGA No data
Right 964451009 3:156813299-156813321 CTGTGTTGGCAGATGAAGCTAGG No data
964451005_964451009 3 Left 964451005 3:156813273-156813295 CCCTATCTCGGGAGGATGCAAAA No data
Right 964451009 3:156813299-156813321 CTGTGTTGGCAGATGAAGCTAGG No data
964451004_964451009 4 Left 964451004 3:156813272-156813294 CCCCTATCTCGGGAGGATGCAAA No data
Right 964451009 3:156813299-156813321 CTGTGTTGGCAGATGAAGCTAGG No data
964451006_964451009 2 Left 964451006 3:156813274-156813296 CCTATCTCGGGAGGATGCAAAAC No data
Right 964451009 3:156813299-156813321 CTGTGTTGGCAGATGAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964451009 Original CRISPR CTGTGTTGGCAGATGAAGCT AGG Intergenic
No off target data available for this crispr