ID: 964451321

View in Genome Browser
Species Human (GRCh38)
Location 3:156816299-156816321
Sequence TCGTGGGCCTCGAAGGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964451321_964451326 4 Left 964451321 3:156816299-156816321 CCCTGATCCTTCGAGGCCCACGA No data
Right 964451326 3:156816326-156816348 GCCCATCCTACTTGCAATAACGG No data
964451321_964451333 30 Left 964451321 3:156816299-156816321 CCCTGATCCTTCGAGGCCCACGA No data
Right 964451333 3:156816352-156816374 CGTTCTCATTCTTCAAAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964451321 Original CRISPR TCGTGGGCCTCGAAGGATCA GGG (reversed) Intergenic
No off target data available for this crispr