ID: 964451511

View in Genome Browser
Species Human (GRCh38)
Location 3:156817062-156817084
Sequence CGCAGGCGGCGCGGCGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964451505_964451511 -6 Left 964451505 3:156817045-156817067 CCGGCGGGCTGCAGGCACGCAGG 0: 1
1: 0
2: 2
3: 19
4: 226
Right 964451511 3:156817062-156817084 CGCAGGCGGCGCGGCGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964451511 Original CRISPR CGCAGGCGGCGCGGCGGCCT GGG Intergenic
No off target data available for this crispr