ID: 964464950

View in Genome Browser
Species Human (GRCh38)
Location 3:156981650-156981672
Sequence TAGGATTAAGTTGAGGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964464945_964464950 25 Left 964464945 3:156981602-156981624 CCTGTCTCTAGCTCTTCCATCTA 0: 2
1: 0
2: 0
3: 15
4: 208
Right 964464950 3:156981650-156981672 TAGGATTAAGTTGAGGAGTATGG 0: 1
1: 0
2: 2
3: 16
4: 164
964464946_964464950 9 Left 964464946 3:156981618-156981640 CCATCTATACTCTATCTACTCTC 0: 1
1: 0
2: 0
3: 19
4: 257
Right 964464950 3:156981650-156981672 TAGGATTAAGTTGAGGAGTATGG 0: 1
1: 0
2: 2
3: 16
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964464950 Original CRISPR TAGGATTAAGTTGAGGAGTA TGG Intronic
900019598 1:180109-180131 TAGGATTAGGGTTAGGATTAGGG - Intergenic
900281346 1:1871482-1871504 TAGGGTGCAGTTGAGGAGTCAGG - Intronic
901853776 1:12031495-12031517 TAGGATTGAGGTGGGGAGGATGG + Intronic
903409259 1:23127184-23127206 TAGAATTATTTTGAGGAATAGGG - Intronic
903689696 1:25164052-25164074 TAGGACCACCTTGAGGAGTAAGG + Intergenic
904887860 1:33754906-33754928 TAGGAGTAAGGTGAGGAGAAGGG + Intronic
908925964 1:69255435-69255457 TTGGATTCAGTTGAGAAATAAGG + Intergenic
910317108 1:85898581-85898603 GAAGATCAAGTTGAGGAGCATGG + Intronic
915645440 1:157268669-157268691 GAGGATGGAGTTGAGGAGTCGGG + Intergenic
920039871 1:203088627-203088649 TAGGATTCAGATGAGGAGAGGGG + Intergenic
920153160 1:203925713-203925735 TAGAATTAAGATGAGTAGTGAGG - Intergenic
922923867 1:229331153-229331175 TAGGAATAATTTGAGGTCTAAGG - Intronic
1062765899 10:64546-64568 TAGGTTTAAGTTATGGAGAAGGG - Intergenic
1064371489 10:14755571-14755593 CAGGATTAAATTGAGGATGATGG - Intronic
1066625488 10:37401772-37401794 TAAGAACAAGTTGAGGACTAAGG - Intergenic
1066694879 10:38068822-38068844 GAGGATAAAGAGGAGGAGTACGG + Intergenic
1066997630 10:42578360-42578382 GAGGATGAAGAGGAGGAGTAGGG - Intronic
1068471885 10:57476018-57476040 TAGGATGAATTTGAAGAGGATGG - Intergenic
1069141298 10:64829256-64829278 TAGGATTGTGGTGAGGATTAAGG - Intergenic
1071982491 10:91017780-91017802 TAGGATTAAAATGATGGGTAAGG + Intergenic
1072178665 10:92956893-92956915 TATGATTATTATGAGGAGTAAGG + Intronic
1074341065 10:112630581-112630603 TAGTATTAAGTGGTGGAGTCAGG + Intronic
1075058173 10:119235705-119235727 TAGGATTTACTTGAGAAATAAGG + Intronic
1079033192 11:17000965-17000987 TAGTGCTGAGTTGAGGAGTAGGG - Intronic
1079454479 11:20624815-20624837 TGTGATTAAGTTGAGGACTGGGG + Intronic
1081836498 11:46159902-46159924 TAGCAGTGAGTTGAGGAGTGGGG - Intergenic
1082586372 11:54946734-54946756 TAGGAGAATGTTGAGGACTATGG - Intergenic
1088504796 11:110517100-110517122 TAAGATAAAGTTGAGGTGCAGGG + Intergenic
1088583424 11:111336535-111336557 TAGGAGTAAGGTCAGGAGTAAGG - Intergenic
1090109003 11:123884566-123884588 CAGGATTAAGTTAAGGAGGAAGG + Exonic
1091990584 12:4952481-4952503 ATGGTTTAAGTTGAGGAGGAAGG + Intergenic
1092737154 12:11593342-11593364 GATGGTTGAGTTGAGGAGTAGGG + Intergenic
1093264377 12:16984523-16984545 TATGGTTATATTGAGGAGTAAGG - Intergenic
1094229074 12:28082252-28082274 TATGATTCAGTTGAGGAGTCTGG + Intergenic
1096587575 12:52632829-52632851 TAGGATTAAGAACAGGAGTGTGG + Intergenic
1097960935 12:65531481-65531503 TAGGAGGGAGTTGAAGAGTATGG - Intergenic
1104310289 12:127648683-127648705 TAGCATTAAGTGGAGGCGTCTGG + Intergenic
1106330204 13:28732882-28732904 TAGGATATAGATGAGGAGGAGGG - Intergenic
1107315566 13:39127931-39127953 TAGGAGCAAGGTTAGGAGTAAGG - Intergenic
1110456406 13:75694814-75694836 GAGGACTAACTTGAGGACTAGGG + Intronic
1113998660 14:16121640-16121662 TAGGAGCAAGTTGAGGCCTATGG - Intergenic
1115343789 14:32320336-32320358 GAGGATTAAGTTGCTGAGTTTGG + Intergenic
1115786655 14:36834313-36834335 TAGGATTAAGTTCTGGAATATGG + Intronic
1120019660 14:79514396-79514418 CAGGACTAAGTTGAGGAAAATGG - Intronic
1120032922 14:79663092-79663114 TTGGATTAATCTGAGGAGTAGGG + Intronic
1120087416 14:80289512-80289534 TAGGAATGAATGGAGGAGTAAGG - Intronic
1122269463 14:100562073-100562095 TAGGATCAAGTTTAGAAGTGGGG + Intronic
1123228038 15:17067458-17067480 TAGGAGCAAGTTGAGGCCTATGG + Intergenic
1126414727 15:48405874-48405896 TAGGATTGAGGTGAGGATTGAGG + Intergenic
1126719385 15:51560885-51560907 TTGTCTCAAGTTGAGGAGTAGGG + Intronic
1133534828 16:6691752-6691774 TATGATTAAGTTGAGGACCTTGG + Intronic
1133758827 16:8781985-8782007 GAGGATTCAGCTCAGGAGTAAGG + Exonic
1138979104 16:62244548-62244570 TAGGGTGAAGTTGAAGAATATGG - Intergenic
1139331344 16:66194287-66194309 TAGGAGCAAGTAGAGGAGTGTGG - Intergenic
1150630087 17:66874199-66874221 CAGGATTAAAATGGGGAGTAAGG + Intronic
1151021003 17:70617488-70617510 AAGGATTAAGGTGAGGTGGATGG - Intergenic
1152958769 18:64135-64157 TAGGTTTAAGTTATGGAGAAGGG - Intronic
1153853163 18:9116337-9116359 AAGGATTAATTTTAAGAGTAGGG - Intronic
1155339516 18:24799621-24799643 TAGGATTTAATGGAGGGGTAGGG - Intergenic
1160632950 18:80258888-80258910 TAGGGGTAAGTTTAGGGGTAGGG + Intergenic
1163914025 19:20223461-20223483 TAGGATTAAATTTAGCAATATGG - Intergenic
1164338231 19:24355229-24355251 TAGGAGTACATTGAGGACTATGG + Intergenic
1166373574 19:42315209-42315231 GAGGATGAAGATGAGGAGGAAGG - Exonic
1168681173 19:58316978-58317000 TAGGAATAAGATGGGGAGGAAGG + Intergenic
928759695 2:34567603-34567625 TAGTATTAAGTTGTGTAGTGGGG - Intergenic
930228660 2:48821355-48821377 TAGGATTCAGTTTAGGAGAGGGG - Intergenic
933895249 2:86805330-86805352 AAGGAATGACTTGAGGAGTATGG + Intronic
935952132 2:108339600-108339622 TAGGATTAACATGAGGATAAAGG + Intergenic
938984235 2:136557985-136558007 CAGGATTAAGGTGAAGAGGAAGG - Intergenic
939002677 2:136754633-136754655 CAGGAGTAAGTTGAGAAGCAAGG + Intergenic
940489145 2:154335124-154335146 TAGGATGCAGTTGAAAAGTAGGG - Intronic
941250767 2:163159175-163159197 TAAAATTTAGTTGTGGAGTAAGG - Intergenic
942999101 2:182301955-182301977 TAGGATTAATTGCAGCAGTAAGG + Intronic
946604922 2:221393074-221393096 TAGGAGTGAGGTTAGGAGTAAGG - Intergenic
947779276 2:232742850-232742872 GATGAATAAGTTGATGAGTAGGG + Intronic
1170007947 20:11689191-11689213 TTGAATTAGATTGAGGAGTAGGG - Intergenic
1171115090 20:22518696-22518718 GGGGATGAAGTTGAGGAGCAGGG + Intergenic
1172044743 20:32072350-32072372 TAGGATTATTGTGAGGATTAGGG - Intronic
1172956426 20:38762767-38762789 TAGGATGAAGATGAAGAATAGGG + Intronic
1173124773 20:40326700-40326722 TGGGAGTAAGTTGAGGTGTAAGG - Intergenic
1173721250 20:45259967-45259989 TAGGACTATGATGAGCAGTAGGG - Intergenic
1173728554 20:45313284-45313306 TAGGATTAGGGTGAGGGTTAGGG - Intronic
1175763247 20:61575282-61575304 CAAGTTTAAGTTGAGGAGAAAGG + Intronic
1176324844 21:5384124-5384146 TAGGAGTAAGTTGAGGCCTATGG + Intergenic
1176482398 21:7314539-7314561 TAGGAGTAAGTTGAGGCCTATGG + Intergenic
1176761575 21:10800927-10800949 TAGGAGCAAGTTGAGGCCTATGG + Intergenic
1177458217 21:21371672-21371694 TAGGAGTAAGTGGAGGAATGGGG - Intronic
1177515211 21:22141158-22141180 GAGACTTAAGTTGAGGAGTTTGG + Intergenic
1178219075 21:30635228-30635250 GAGGATTTGGTTGAGGAGCAAGG - Exonic
1180401240 22:12429088-12429110 TAGGAGCAAGTTGAGGCCTATGG + Intergenic
950273343 3:11637801-11637823 TAGGATTTTGTTGTGGAGTTGGG + Intronic
952038912 3:29238024-29238046 TAGGTGTATGTGGAGGAGTAGGG - Intergenic
952486412 3:33816167-33816189 TAGGAGAAAGTTTTGGAGTAGGG + Intronic
956672190 3:71701418-71701440 TAGGATTAGGATGAGGATTGAGG + Intronic
957233824 3:77558428-77558450 TAGCATTAATATGAGTAGTAGGG + Intronic
959086341 3:101854330-101854352 TAGATTTAAGTTGATCAGTATGG + Intronic
959141419 3:102491045-102491067 TAGGGTTAACTTGAGAACTAGGG + Intergenic
960073353 3:113456859-113456881 TAGCATTAAGATGCAGAGTAAGG - Intronic
963580104 3:147115459-147115481 TGGGATTAAGTTGTGGATTTTGG + Intergenic
963738129 3:149044917-149044939 TAGGAATAAGGTCAGAAGTAGGG - Intronic
964278410 3:155034103-155034125 TACTGTTAAGTTGAGGAGGAAGG - Intronic
964464950 3:156981650-156981672 TAGGATTAAGTTGAGGAGTATGG + Intronic
966303845 3:178508935-178508957 GAGGATTCTGTTGAAGAGTAGGG + Intronic
966665958 3:182471312-182471334 TGTGATTATCTTGAGGAGTAGGG + Intergenic
974209585 4:58752673-58752695 CAGGATTAAGGTAAGGATTAAGG + Intergenic
976418681 4:84811549-84811571 CATGATTAAGTGCAGGAGTAGGG - Intronic
977069819 4:92371031-92371053 TTGGATTAAATTGTGGTGTAAGG - Intronic
978064934 4:104385716-104385738 TAGGATTGAGTTCATGAGCATGG - Intergenic
978655883 4:111064802-111064824 TGGGATGAGGGTGAGGAGTAGGG + Intergenic
980153205 4:129073772-129073794 AATGATTATGTTGAGGAGTCTGG - Intronic
980271868 4:130594486-130594508 TAGGATTAAGGTGACAAGCAAGG - Intergenic
981770678 4:148304259-148304281 AAGGATTGAGTTCAGGAGAAGGG + Intronic
981866355 4:149424389-149424411 TAGTTTTAAATTGAGGAATATGG + Intergenic
983518039 4:168677811-168677833 CAGGATTAACTGGCGGAGTAGGG - Intronic
984720619 4:182969773-182969795 GAAGATTAAGTGGAGGAGCATGG - Intergenic
984805740 4:183749725-183749747 TAGGCTTAACTTCAGGAGAAAGG + Intergenic
987594342 5:19976898-19976920 AAGGATTAAGTAGAGTAGTATGG + Intronic
988157792 5:27477139-27477161 TAGGATTAGGTTCAGGGGAAGGG + Intergenic
989682726 5:44047812-44047834 TAAGATTAAATTGAGAAGGAAGG + Intergenic
990783420 5:59392865-59392887 TAGGATTAATTTAACGAGTCTGG + Intronic
991995617 5:72383544-72383566 TAGGATTAAGGTGAGGAATTAGG - Intergenic
992462180 5:76971579-76971601 TAGGATTAGGGTGAGGATTAGGG - Intronic
993222459 5:85117659-85117681 TAGGATTAAATTTAGGAATGAGG - Intergenic
993981005 5:94543719-94543741 TAGGATTAAGTTTAGGATTAAGG + Intronic
994339584 5:98610684-98610706 TAAGATTAGGTTGAGAAGTGAGG + Intergenic
994441140 5:99804651-99804673 TAGGAATGATTTGATGAGTAAGG - Intergenic
1004016802 6:11738826-11738848 TAGGATGAAGTCGAGGTATATGG - Intronic
1007228079 6:40328726-40328748 TAGGAACAAGTAGAGGAGTGGGG - Intergenic
1007694532 6:43723959-43723981 AAGGAGGAAGGTGAGGAGTAAGG + Intergenic
1010467014 6:76179770-76179792 GTGGATTGATTTGAGGAGTATGG - Intergenic
1011531553 6:88327869-88327891 AAGGATCAAGTTTTGGAGTAGGG - Intergenic
1013383046 6:109596423-109596445 TAGGATGAGGATGAGGAGTTTGG - Intronic
1014791572 6:125678370-125678392 TAGGATTATTTTGAGGATAAAGG - Intergenic
1015731187 6:136349826-136349848 CAGGAGTAAGGTGAGGAGTAGGG + Intronic
1015743042 6:136479107-136479129 TAGTATTATGTTGAGGATTTTGG - Intronic
1023356714 7:39374702-39374724 TTGGATTGAGTGGAGGAGTGGGG + Intronic
1023429900 7:40079893-40079915 TAGGATTGATTTGGGGAGTAGGG + Intronic
1023435740 7:40138971-40138993 TTGGATTAAGTTTAGGAATCAGG + Intronic
1025584232 7:62761946-62761968 TGGGAGTAAATTGAGGAGTATGG - Intergenic
1026159016 7:67852618-67852640 GAGGGATAAGTTGAGGAGGATGG + Intergenic
1028407559 7:90492867-90492889 TAGAATTGAGTTGAGGAGAGCGG - Intronic
1028448371 7:90951270-90951292 TCTGATTAATTTGGGGAGTAAGG + Intronic
1030118869 7:106086812-106086834 TAAGATCAATTTGAGGAGAATGG - Intergenic
1030214883 7:107034363-107034385 TTTGATTAAGTTGAGGAGTATGG - Intergenic
1035984926 8:4417969-4417991 TAGTCTTAAGTGGAAGAGTAAGG - Intronic
1037287943 8:17320894-17320916 TAGGATTAAGTTGAACACTTTGG - Intronic
1038006160 8:23432427-23432449 CAGCATTAAATTGAGGAGTGGGG - Exonic
1039125228 8:34193751-34193773 TAGGATTCTGTTGAGAAATATGG - Intergenic
1041129782 8:54685847-54685869 AAGGATTAATTCGAGAAGTAAGG - Intergenic
1042456203 8:69006862-69006884 TAGGGATAATTTGAGGAGTAAGG + Intergenic
1044111905 8:88285671-88285693 AAGGATTCAGTTGAGGGGGAGGG - Intronic
1044653084 8:94519261-94519283 TATGATCAAGATGAGGAGGAAGG - Exonic
1050342178 9:4651581-4651603 TAGTATTATGTTGAGGATTTTGG - Intronic
1050680131 9:8101345-8101367 TAGGATTTTGTTGAGGATTTGGG + Intergenic
1051000739 9:12279139-12279161 TAGGGTAAAGAGGAGGAGTAAGG - Intergenic
1052380893 9:27769900-27769922 TAGGATAAAGCTGAGCTGTAAGG - Intergenic
1055601979 9:77929164-77929186 TAGGAATAAGTTGAGCAGATTGG - Intronic
1056451460 9:86721330-86721352 TACCATTAATTTGAGGAGCAAGG + Intergenic
1057538013 9:95934723-95934745 GAGGATTAAGTTAAGGATTTGGG + Intronic
1057568791 9:96187552-96187574 TAGGGTTGGGGTGAGGAGTAGGG + Intergenic
1058204689 9:102088943-102088965 AAAAATTAAGTTGAGGATTAAGG + Intergenic
1058568776 9:106317452-106317474 TAGGATAAATTTTAAGAGTATGG + Intergenic
1058850180 9:109004256-109004278 TAGGGTAATGTTTAGGAGTACGG - Intronic
1061280117 9:129593139-129593161 CATGATGAAGTTCAGGAGTAGGG + Intergenic
1062749046 9:138237364-138237386 TAGGATTAGGGTTAGGATTAGGG + Intergenic
1203402242 Un_KI270519v1:119859-119881 TAGGAGCAAGTTGAGGCCTATGG + Intergenic
1187469737 X:19558595-19558617 TAGGATAAAATTCAGCAGTAGGG - Intronic
1188388731 X:29593198-29593220 TGGGATAAAGTGGAGGAGGAGGG - Intronic
1189352304 X:40284950-40284972 TGGGATGATGTTGAGGAGAAAGG - Intergenic
1191264487 X:58371454-58371476 TAGGATCTCGTTGAGGACTATGG - Intergenic
1191732943 X:64356930-64356952 CAGGATTAAGTTCTGGAATAAGG + Intronic
1191966053 X:66759670-66759692 TAGGATCAAATTAAAGAGTAAGG - Intergenic
1199403682 X:147430159-147430181 TAGGATAAATTTGAGGTGTTTGG + Intergenic
1199907722 X:152251417-152251439 TAGGTTTAAGTTTTGGAGGAGGG - Intronic
1200392112 X:155955082-155955104 TAGGGTTAAGTTTAGGGGTTAGG + Intergenic
1200679105 Y:6188179-6188201 TAGGATTGCTTTGAGTAGTATGG - Intergenic
1201754308 Y:17469561-17469583 TATGATTAAGTTTAGGTTTAGGG + Intergenic
1201847244 Y:18436424-18436446 TATGATTAAGTTTAGGTTTAGGG - Intergenic
1202133371 Y:21634813-21634835 TAGGATTTAGTTTAGGGTTAGGG + Intergenic
1202172632 Y:22067075-22067097 CAGGATTAAGTTTAGGGATATGG - Intergenic
1202218730 Y:22519296-22519318 CAGGATTAAGTTTAGGGATATGG + Intergenic
1202324456 Y:23676759-23676781 CAGGATTAAGTTTAGGGATATGG - Intergenic
1202546315 Y:25993295-25993317 CAGGATTAAGTTTAGGGATATGG + Intergenic