ID: 964467667

View in Genome Browser
Species Human (GRCh38)
Location 3:157015066-157015088
Sequence CTGGAAACAGAAGTCAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 336}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964467667 Original CRISPR CTGGAAACAGAAGTCAAACA AGG Intronic
900807779 1:4779083-4779105 CAGGAGACAGAAGTAAAATAGGG + Intronic
901315990 1:8308801-8308823 CTGGAAAGAGAAGAAAATCAAGG + Intergenic
901636199 1:10671415-10671437 GTGGTAACAGAACACAAACATGG + Intronic
903551139 1:24157966-24157988 CTAGAAACAGACCTCAGACAAGG + Intronic
904419029 1:30379586-30379608 CAGGACACAGAAGCCATACAGGG + Intergenic
904943450 1:34181382-34181404 CAGGAAACAGAATGCAGACAGGG - Intronic
905374643 1:37511309-37511331 AAAGAAACAGAAGTCAAAAAAGG + Intronic
905949244 1:41933886-41933908 CTGGATTCAGAAGTGAAGCAGGG - Intronic
907713987 1:56910809-56910831 CTGGAAACAGAAGTCAACTGAGG - Intronic
908229250 1:62087459-62087481 CAGGAGACAGCAGGCAAACAGGG + Intronic
908366496 1:63429088-63429110 CTGGAAAGAAATGTAAAACATGG - Exonic
909304763 1:74060119-74060141 CTAGAATCAGAAATGAAACAGGG - Intronic
910502089 1:87904009-87904031 CTGGAATCTGAAGACAAACATGG - Intergenic
911693758 1:100864117-100864139 GAGGAAACAGAAGCCAAAGAGGG - Intergenic
915384830 1:155480888-155480910 CTGGATTCAGAAGTCAAACTTGG + Exonic
918369274 1:183842414-183842436 CTGGAAACGGAATTGAAATATGG + Intronic
918432656 1:184478168-184478190 CTAAAAACAGAAGTCCAAAAGGG + Intronic
918647330 1:186919277-186919299 CTGGAACCAGAAGGCAAGTAGGG - Intronic
919359795 1:196578328-196578350 CTGGAAAGACAAGTCACTCAGGG + Intronic
920785682 1:209038877-209038899 CTGGAAACAGTAGACATAGAAGG - Intergenic
921546794 1:216483072-216483094 CTCAAACCAGAAGTCAAGCATGG + Intergenic
921901003 1:220450782-220450804 AGCGAAACAGAAGCCAAACATGG - Intergenic
923357851 1:233178256-233178278 GGGGAAACAAAAGTTAAACATGG - Intronic
923371601 1:233319413-233319435 CAGGAAACTGAAGTCAAAGCAGG + Intergenic
924821878 1:247500674-247500696 CTAGACTCAGAAGTCACACATGG - Intergenic
1063033036 10:2255278-2255300 CTGCAAACAAAAGCCAAACTTGG + Intergenic
1063041784 10:2347983-2348005 CTAAAAAGATAAGTCAAACAAGG + Intergenic
1063051250 10:2451514-2451536 CTGGAAACTCCACTCAAACAGGG + Intergenic
1063618149 10:7620227-7620249 CTATAAACACAAGTCAAACTTGG + Intronic
1063979596 10:11443003-11443025 ATGGAAACACAGGTCAAATAAGG + Intergenic
1064694211 10:17949509-17949531 CTAGAATCAGCAGTCAAAGAGGG - Intergenic
1066507401 10:36059775-36059797 CTGGAAACAGAATCCAGGCAAGG + Intergenic
1067548547 10:47215623-47215645 CTGGAAAGAGAAGTCCATCCTGG - Intergenic
1068853908 10:61777093-61777115 CTGGAGACAGACATTAAACATGG - Intergenic
1068894393 10:62183413-62183435 CTGCAAACAGAAGTCTTACTAGG + Intronic
1069754319 10:70763972-70763994 CTGGACACAGAAGACAGCCATGG - Intergenic
1070085248 10:73230697-73230719 CTGGAAAGAGAAGACATACGTGG + Intronic
1070617366 10:77979292-77979314 CTGGAAACAGCAGCCAGACTTGG + Intronic
1070662078 10:78314151-78314173 CTGGTTACAGAAATCAAACTGGG + Intergenic
1071282095 10:84112287-84112309 CTAGAACCAGAAGGCAAGCAAGG + Intergenic
1071749631 10:88459971-88459993 CTGGAAAAAGAAGGCAAAAAGGG + Intronic
1071956545 10:90766991-90767013 CTGGGATCCGAAGTCAAGCAGGG + Intronic
1072941579 10:99768905-99768927 CTGGGAACACAACACAAACAGGG + Intergenic
1073071893 10:100799510-100799532 CTTGACAGAGAAGGCAAACATGG + Intronic
1073117635 10:101100633-101100655 CTGGGAATGGAAGTGAAACAGGG - Intronic
1074840290 10:117344690-117344712 CTGGCAATAGAAGTCTAGCATGG - Intronic
1074846745 10:117405497-117405519 CTGGAATCAAAATTCCAACAGGG + Intergenic
1075143642 10:119864261-119864283 CTGGAGACAGAAGTCTGACATGG - Intronic
1075212587 10:120503501-120503523 CTGGAAACTGAAGTCAGAATAGG - Intronic
1075371359 10:121938275-121938297 CTGGTATCAGAAGTGAAAGAGGG + Intergenic
1075521600 10:123146822-123146844 CTGGAAACTGAAGTGAGGCAAGG - Intergenic
1075970777 10:126650347-126650369 CTGGGAACAGAGGTGAAAAATGG - Intronic
1076994909 11:293140-293162 CTGGACACACAAGTCCAAGATGG - Intronic
1077730518 11:4724316-4724338 CTGAAAACAGAAGTGGAAGATGG + Intronic
1079884195 11:25965859-25965881 CTGCAAACAGCATTCAAAGAGGG + Intergenic
1080856804 11:36118874-36118896 ATAGAAACAGAAATCAAACTGGG - Intronic
1081036578 11:38154622-38154644 CTGGAAACCTCAGTCAGACAGGG + Intergenic
1081195968 11:40161085-40161107 CTAGGAACAGAAGTAAAACTTGG + Intronic
1083128492 11:60598197-60598219 CTGAAAATAGAAGCCAAAAAGGG + Intergenic
1083393614 11:62373235-62373257 CTGGGACGGGAAGTCAAACAAGG + Intronic
1083918537 11:65766618-65766640 CTGGAAACAGAAGTCGTTCGTGG + Intergenic
1086435425 11:86775295-86775317 CTGGAGGCAGAAGCCTAACATGG - Intergenic
1087494389 11:98871776-98871798 TTGAAAACAGAATACAAACAAGG + Intergenic
1087524394 11:99290782-99290804 CTGGAAGAAGCAGTTAAACATGG - Intronic
1088382532 11:109210634-109210656 CAGGAAACAAAAGCCAAAAATGG - Intergenic
1088442915 11:109891661-109891683 GCTGAACCAGAAGTCAAACATGG - Intergenic
1089978837 11:122755704-122755726 CTGGGGACAGAAGTCAAATTAGG + Intronic
1090139479 11:124239499-124239521 CTGTAAACAGAAATAAAAGATGG + Intergenic
1093480260 12:19597356-19597378 CTGAAATCAGAAGGAAAACAGGG - Intronic
1094585803 12:31776412-31776434 CTAGACACAGAAGGCCAACAGGG - Intergenic
1096071613 12:48778495-48778517 CTGGAAGCAGAAGACCAACTAGG + Intronic
1099967550 12:89465592-89465614 CTAGAAACAGAAGCAAAAAATGG + Intronic
1100282196 12:93128510-93128532 ATGGAAACAGAAGCCAGGCACGG - Intergenic
1100512883 12:95294399-95294421 TTAGAAACAGAAATCCAACAAGG - Intronic
1102228850 12:111248493-111248515 CTGGAAGCAGAAGTAGGACAAGG + Intronic
1103587968 12:121970271-121970293 TTGGAAACAGATGCCAGACAAGG - Intronic
1103612444 12:122132220-122132242 CTGGAATCAAGACTCAAACAGGG - Intronic
1104238006 12:126958527-126958549 CTGGAATCAGAAGACAGAAATGG + Intergenic
1104594894 12:130114265-130114287 TTGGAGACAGAAGCCAGACACGG + Intergenic
1105662622 13:22515370-22515392 CAGGAAACACAAGTCAAAACTGG + Intergenic
1105789765 13:23787000-23787022 CTAGGAGCAGAAGTCACACATGG + Intronic
1106602335 13:31199101-31199123 TTGGAAACAGAAGTGAGCCAAGG + Intergenic
1106635724 13:31526543-31526565 CTGGAAAGAAAAGTTGAACAAGG + Intergenic
1106757107 13:32832804-32832826 CTAGAAACAGAAATAAAAGAGGG - Intergenic
1108427264 13:50315402-50315424 CTGTAAAGAGAAGTTAAATAGGG - Intronic
1109642624 13:65210044-65210066 ATGGAAACAGAAATCACAAAAGG - Intergenic
1110776368 13:79412725-79412747 CTGGGATCAGAAGACATACATGG + Intergenic
1111588472 13:90311996-90312018 CTAGAAACAGAAGAAAAAAAGGG - Intergenic
1112079005 13:95947173-95947195 CTGGAAAAAGAAGATGAACAAGG + Intronic
1112191365 13:97181103-97181125 ATGGAAGCAGAAGTCAGAGAAGG - Intergenic
1112686415 13:101833047-101833069 CTGGAATCAGAGGTCTAGCATGG + Intronic
1114563279 14:23608854-23608876 CTGATAACAGAATTCAAGCATGG - Intergenic
1115212924 14:30985721-30985743 CTATAAACATAAGTCAAACATGG - Intronic
1116088421 14:40271805-40271827 TTTGAGACAGAAGTCAAATAAGG - Intergenic
1116270506 14:42759311-42759333 CTGGGAAGAGAACTCAAGCAAGG - Intergenic
1116575667 14:46571945-46571967 CTGGAAAAAGAAGTAAAAAGAGG - Intergenic
1117461749 14:55952274-55952296 CTGGTAAGAGGAGACAAACAAGG + Intergenic
1119116665 14:72028352-72028374 CAGGAAATAAAAGACAAACAAGG + Intronic
1119451391 14:74713928-74713950 CTGGAAACGCCAGACAAACAAGG - Intronic
1119510673 14:75208643-75208665 CTTGAAACAGAACACAATCACGG - Intergenic
1121996821 14:98609044-98609066 CTGCAAACAGATGTCAGATATGG - Intergenic
1122293670 14:100693221-100693243 GTGGAGACAGACCTCAAACAAGG - Intergenic
1122331219 14:100915606-100915628 CTGGTAAAGGAAGTGAAACAGGG - Intergenic
1123919251 15:25059015-25059037 ATGGAAACAGAGGTCACTCATGG + Intergenic
1124563407 15:30794977-30794999 CTGGAAACACAAGACCAAAAAGG - Intergenic
1124875825 15:33592471-33592493 CTGGATACAGATATCCAACAAGG - Intronic
1125624325 15:41094308-41094330 GTGGAAAAAGAAGTCTAATATGG - Intronic
1126606635 15:50484387-50484409 CTGGAAAAAAAAGCCAAACATGG + Intronic
1128612531 15:69085356-69085378 GTGTAAACAGAGGTCACACAGGG + Intergenic
1129538565 15:76333538-76333560 CTGTGACCAGAAGTCACACATGG + Intergenic
1133363852 16:5195612-5195634 TTGGAGACAGATGACAAACAAGG - Intergenic
1135823452 16:25705195-25705217 GAGGTAACAAAAGTCAAACAGGG - Intronic
1138183008 16:54955551-54955573 CTGGCAACAGTAGGCAAAAATGG + Intergenic
1138621787 16:58217262-58217284 TTGAAAACAGAAGTAAAACTAGG + Intergenic
1140289310 16:73636328-73636350 CTGGCAACAAAAATAAAACAAGG + Intergenic
1140929824 16:79617184-79617206 ATGGAACCAGAAGTCAAGGAGGG + Intergenic
1141370475 16:83481853-83481875 CTGGAAACACAAGACAAGCCCGG + Intronic
1141894932 16:86953300-86953322 CTGCAAACAGAAGTCACTCCAGG - Intergenic
1142378515 16:89719090-89719112 CTGGACACAGGAGGCATACACGG - Exonic
1142922220 17:3199085-3199107 CAGGAAACAGAAATCACACTTGG + Intergenic
1143083663 17:4399822-4399844 CAGAAAGCAGAAGTCAAGCAGGG - Intergenic
1143378773 17:6482877-6482899 ATGGAGACAGGAGTCAAACTCGG - Intronic
1144054087 17:11523486-11523508 CTGGAGCCAGAAGTCAAAGTGGG + Intronic
1146488965 17:33266198-33266220 TTGTATACAGAACTCAAACAGGG - Intronic
1147846667 17:43409125-43409147 CTGAAATCAGAAGAGAAACAGGG + Intergenic
1149054381 17:52345353-52345375 ATGGCAACAGAAATCAAAAAAGG - Intergenic
1149298264 17:55280971-55280993 CTGGAAACCAAAGTCATACCAGG - Intronic
1149723476 17:58868702-58868724 AAGGAAAGAGAAGTTAAACAGGG - Intronic
1150010892 17:61502461-61502483 CGGGAAACAGAAGGCGGACATGG + Intergenic
1150498490 17:65627716-65627738 CTGGAATTAAAAGGCAAACAAGG - Intronic
1151221017 17:72613240-72613262 CTGGAGTCAAAAGTCACACAGGG - Intergenic
1153854560 18:9133351-9133373 CTAGAAACAGAGGTCAGACAGGG + Intronic
1154262950 18:12853952-12853974 GTGGGAACAGAAGGGAAACAAGG + Intronic
1155114571 18:22751863-22751885 CTTGAAGCAGAAGCCAGACATGG - Intergenic
1156223603 18:35079723-35079745 CTGGATACAGAAATCTAACAGGG - Intronic
1156566325 18:38195656-38195678 CTGTAAACAGAAATCAAGGAAGG - Intergenic
1156726988 18:40140435-40140457 CTGCAAACAGAGGGCAAAGAAGG + Intergenic
1157652059 18:49343235-49343257 ATGGATGCAGAAGTCATACAGGG - Intronic
1158692485 18:59673046-59673068 CTGGAAACATGACTCCAACATGG + Intronic
1158942207 18:62415102-62415124 CTGGCAACGGAAGTCAGGCATGG + Intergenic
1159038608 18:63301283-63301305 CTGGAAACAGATGTCAGTAATGG + Intronic
1159702070 18:71641125-71641147 CGGGAAAGAGCAGGCAAACAGGG + Intergenic
1159855557 18:73583347-73583369 CTTGAAACAGCAGGCAAAGAGGG + Intergenic
1166306129 19:41938088-41938110 CGGTAAACAGAAATCAATCAGGG + Intergenic
1166646444 19:44535312-44535334 CTGGAAGCAGAAGAGAGACACGG - Intergenic
1167071053 19:47222096-47222118 CTGGAGGCAGAGGACAAACACGG + Intronic
1167372291 19:49090378-49090400 CTGGAGACAGTGGTAAAACAGGG - Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1168266380 19:55225941-55225963 ATGGATGCAGAAGTCAAATAGGG + Intergenic
1168670755 19:58239362-58239384 CTGGAAACTGTCTTCAAACATGG + Intronic
925569576 2:5294746-5294768 CTGGAAACATAAATCATTCATGG + Intergenic
926023273 2:9515853-9515875 CTGGCAACACAATTCCAACAAGG - Intronic
926241581 2:11092988-11093010 CTGCAAACTGCAGGCAAACAAGG + Intergenic
926680537 2:15660506-15660528 CTGTAATCAAAATTCAAACAGGG + Intergenic
927778994 2:25924380-25924402 TTGGAAGAAGAAGTGAAACATGG + Intergenic
928424177 2:31164457-31164479 ATGGAGTCAGAACTCAAACATGG - Intergenic
929088044 2:38187951-38187973 CGGGAAACAGGAGAAAAACAAGG + Intergenic
930156792 2:48114123-48114145 CTGAAAACAGAAATGAAACTAGG - Intergenic
930270495 2:49250939-49250961 CTACAAACAGAAGTCAATAATGG - Intergenic
930545577 2:52762755-52762777 GTGGAAACAGAGGTTATACAAGG + Intergenic
931206355 2:60149350-60149372 CTGGAAACATCAGTCTAAGAAGG + Intergenic
931226171 2:60333954-60333976 ATGGATACAGAAGCCAAAGAGGG + Intergenic
932115102 2:69039294-69039316 AGTGAAACAGAAGTCAAACTTGG + Intronic
932450276 2:71805528-71805550 ATGGAAGCAAAAGTGAAACAAGG + Intergenic
932620975 2:73264849-73264871 CTGGAAACAGAAGGCAGGCATGG + Intronic
934528578 2:95069623-95069645 CTGGAGGAAGAAGTCAAGCAAGG + Intergenic
934726763 2:96626225-96626247 TTTTAACCAGAAGTCAAACAAGG + Intronic
935134574 2:100288654-100288676 CTGGGGACAGAAGTCAGAAAAGG - Intronic
935212930 2:100953979-100954001 CTGGGAACAGGAGGCACACATGG + Intronic
937115359 2:119401098-119401120 AAGGAAACAAAAGTGAAACAGGG - Intergenic
938963853 2:136368517-136368539 CTTGATACAAAAGCCAAACAAGG + Intergenic
940389291 2:153112589-153112611 CTGGGAACAGAAGATTAACATGG - Intergenic
941661660 2:168201693-168201715 TGGGAACCAGAAGTGAAACATGG - Intronic
943769894 2:191705129-191705151 CTGGGAAGAGAAGTCAAGCTAGG + Intergenic
944385945 2:199164771-199164793 CTGCAAACAGAACTCAGCCACGG - Intergenic
944862522 2:203828580-203828602 CTGGAAACAGAAGAGAAATGAGG - Intergenic
945011852 2:205472653-205472675 CCAGAAACAGAAGCCAAATAGGG + Intronic
946975914 2:225150662-225150684 CTGGAAACATAAATCACCCACGG + Intergenic
947976142 2:234368083-234368105 ATGTGAACAGAAGTCATACAGGG - Intergenic
1168776848 20:455144-455166 CAGGAAACAGCAGTCAAGCCAGG - Intronic
1168981625 20:2008868-2008890 CTGAAAACACAAGACAGACAGGG - Intergenic
1170911918 20:20580612-20580634 CTGGAAACAGGGGTCATGCAGGG - Intronic
1171032281 20:21688016-21688038 TTTGAATCAGAATTCAAACAAGG + Intergenic
1171133832 20:22678746-22678768 CTGGAAACAGTGGGAAAACAGGG - Intergenic
1171191907 20:23164797-23164819 CTGGACACAGAAGTGGAAAATGG - Intergenic
1172176431 20:32975067-32975089 GTGTATAGAGAAGTCAAACATGG + Intergenic
1172801747 20:37580974-37580996 CTGGACACAAAAGCCACACAAGG - Intergenic
1174220613 20:48951821-48951843 CTGGCAGCAGAAATCGAACAGGG - Intronic
1175879942 20:62251822-62251844 CTTGAAACAGGATGCAAACAAGG - Intronic
1176118666 20:63444435-63444457 CTGGAGACAGATGACAAAGATGG + Intronic
1178288423 21:31345371-31345393 CTGGAAACAGTACTCTAAAAAGG + Intronic
1178438568 21:32580725-32580747 CAGGAAACAGAACCCAGACAAGG + Intronic
1178484694 21:33011372-33011394 CTGGTAATAGAAGTCATACATGG - Intergenic
1179023388 21:37659171-37659193 CTGGAAAAAAAAGAAAAACAGGG - Intronic
1179438343 21:41377127-41377149 CAGGAAACAGGAGCCAACCAAGG + Exonic
1181319121 22:21991167-21991189 CAGGGAACAGAAGTCAGAGAGGG - Intergenic
1182718519 22:32378678-32378700 CTGGAAACAGTGGTCAAAGGTGG + Intronic
1183074874 22:35420446-35420468 CTGGAGACAGGATTCAAACCAGG - Intronic
1183811956 22:40265259-40265281 CAGGGAACAGCAGTCAAAGATGG + Exonic
1184957649 22:47902388-47902410 TTGGAAAGAGAAATCAAAGAAGG - Intergenic
1185357430 22:50382301-50382323 CTGGATAAAAAAGTCAAACAGGG + Intronic
951629583 3:24705081-24705103 CTGGAAAAATCAGTCAAAAAAGG - Intergenic
952743342 3:36755957-36755979 CTGGAATGAGAAGTGACACATGG + Intergenic
953687047 3:45086048-45086070 TAGGAAAAAGAAGACAAACAAGG - Exonic
954697055 3:52433208-52433230 CATGAAACAGAAGTCACTCAGGG + Exonic
954960072 3:54556698-54556720 TTTGAAACAGAACACAAACAAGG + Intronic
955414732 3:58681396-58681418 CTGGAACCAGGACTCAGACATGG + Intergenic
955734561 3:62024031-62024053 TTGGAAAGACAAGTGAAACAAGG + Intronic
956636898 3:71374144-71374166 CTAGAAACGGATGTCAACCAAGG - Intronic
957171377 3:76741190-76741212 CAGGAAACAGTAGATAAACAAGG - Intronic
957618878 3:82569353-82569375 CTGTAAATAGAAATCAAACTGGG - Intergenic
958122216 3:89305736-89305758 CGGGAGACTGGAGTCAAACATGG - Intronic
958876479 3:99623309-99623331 CTGGATACAGAAGGCAGAAAAGG + Intergenic
959437370 3:106333125-106333147 CTGGGAAAAGAAGGCATACAAGG + Intergenic
961626545 3:128268069-128268091 CTGGAAACAGAAGTGAGGCTAGG + Intronic
962436892 3:135375130-135375152 CTGGAAACAGAATTTAGACTAGG - Intergenic
964467667 3:157015066-157015088 CTGGAAACAGAAGTCAAACAAGG + Intronic
964719966 3:159761608-159761630 CTGGAAACAGAAAGGAAACTGGG + Intronic
965969786 3:174540696-174540718 AGGAAAACAGAAGTCAAATAGGG - Intronic
966399469 3:179534113-179534135 CTGGAAAGAAAATTAAAACAAGG + Intergenic
966601802 3:181782774-181782796 CAGGAAGCAGAATTCACACAGGG - Intergenic
966772419 3:183515811-183515833 CTGGAAAAAGAAGAGAAAGAGGG + Intronic
966837222 3:184058602-184058624 CTGGGATCAGAAGTCAAACAGGG - Intronic
967711277 3:192711172-192711194 CTGGAAACAGAGGTTATAGAGGG + Intronic
968859902 4:3159316-3159338 CTGGAAAGAGAAGTTCACCATGG - Intronic
969456147 4:7300782-7300804 CTGCAGACAGAAATCAAGCAAGG - Intronic
970353132 4:15226241-15226263 GTGGAAACAGATTTCAAACTCGG - Intergenic
970760626 4:19481423-19481445 CTGCAGACAAATGTCAAACATGG + Intergenic
971718596 4:30214904-30214926 CTGAAAACAGAAATGAATCATGG + Intergenic
971727656 4:30334443-30334465 AAGGAAACATTAGTCAAACAGGG - Intergenic
971933913 4:33122040-33122062 CAGGAACAAGAAGTTAAACATGG + Intergenic
973624327 4:52756423-52756445 CTTGGAACACAAGTCATACAAGG + Intergenic
975088157 4:70367832-70367854 CTGAAGAAAAAAGTCAAACATGG - Intergenic
978199642 4:106010888-106010910 CTGAAAACATAAATCTAACAGGG - Intergenic
978250947 4:106631041-106631063 ATGGAGACAGAAGTCACACATGG + Intergenic
978473570 4:109098909-109098931 CTGGAGCCAGAAGTGAACCAAGG - Intronic
979159567 4:117442462-117442484 CAGGAATCAAAAGCCAAACATGG - Intergenic
980156261 4:129110670-129110692 CAGGAAGGAGAAGGCAAACAGGG - Intronic
980248277 4:130276809-130276831 CTGAAAAAATAAGTCAAGCATGG - Intergenic
980979132 4:139639050-139639072 ATGGACTGAGAAGTCAAACAAGG + Intergenic
981405992 4:144369784-144369806 CTGGAAACATAAGACAAACTAGG + Intergenic
983043513 4:162957844-162957866 GTAGAGAGAGAAGTCAAACAGGG - Intergenic
984211029 4:176848640-176848662 CTGGAAACAGGAATCAGAGAAGG + Intergenic
985249414 4:188008329-188008351 CTGGAAAAATAAACCAAACATGG - Intergenic
985285794 4:188335556-188335578 TTGGATACAGAAATCACACAAGG + Intergenic
986404510 5:7412297-7412319 CTGGAAAAAAAAGTCATACTAGG + Intronic
986748228 5:10761942-10761964 TGGGAAGCGGAAGTCAAACATGG + Intergenic
986970228 5:13326020-13326042 CTGGAATAACAAGTCAAACATGG + Intergenic
988939962 5:36134648-36134670 CAGAAGACAGAAGACAAACATGG + Intronic
988942280 5:36158619-36158641 ATGGAAACAGAAATCAATCAGGG - Intronic
988986680 5:36626289-36626311 CTAGAAGCAAAAGTCAAACAAGG - Intronic
991147723 5:63326179-63326201 ATGGAAACAGAAGCAAATCAAGG - Intergenic
991235283 5:64387826-64387848 CTGAAAACAGAAATCAATAAAGG + Intergenic
991301904 5:65136775-65136797 CTGCAAACAGAAGCCAGAAATGG - Intergenic
993789653 5:92193219-92193241 CAGGAACAAGAAGTTAAACATGG + Intergenic
994016927 5:94977914-94977936 CAGGAAACAAAAGTAAAACCAGG + Intronic
996387861 5:122927719-122927741 CTAGAAACAGAAGTCAAATAGGG - Intronic
999563935 5:152836785-152836807 TTGGAAACATAAGAAAAACATGG + Intergenic
1001188638 5:169604079-169604101 CTTCAAACAGAAGTTAAAGAAGG + Exonic
1003134003 6:3418890-3418912 CCAGAAGCAGAAGTCAAACAAGG - Intronic
1003271788 6:4613946-4613968 GTGGAAACAGAAACCAAACCAGG - Intergenic
1003735373 6:8872290-8872312 CTGGAAACAAAGATAAAACATGG - Intergenic
1004155070 6:13160181-13160203 CTACAAACAAAAGACAAACAGGG - Intronic
1004303386 6:14478352-14478374 ATAGATACAGAATTCAAACATGG - Intergenic
1005710377 6:28498674-28498696 CTAGAGACAGAAGTCAAGAAAGG + Intergenic
1006144397 6:31949781-31949803 GTGGAAACAGAAGCCAAAGGAGG + Intronic
1006790472 6:36697987-36698009 CTTGACATAGAAGTTAAACAGGG - Intronic
1007639762 6:43328886-43328908 GTGGAATAAGAAGTCAATCAAGG - Intronic
1009418588 6:63441477-63441499 ATGGAAACAGCATGCAAACAAGG + Intergenic
1009711651 6:67329965-67329987 CAGTATACAGAACTCAAACAGGG - Intergenic
1010404193 6:75484074-75484096 GTGGAAAAAGAAGTAAAGCAAGG - Intronic
1010684028 6:78831027-78831049 ATAGAAACAGAAGGCACACATGG + Intergenic
1010917257 6:81635525-81635547 CTGGAAACAGAAAATAAACCAGG + Intronic
1011114034 6:83870474-83870496 CTGAAAACAGAAATGAACCAAGG - Intronic
1012927813 6:105285083-105285105 CTTGAAACAGAAGTCAAGGCAGG - Intronic
1016563903 6:145430289-145430311 GTGGAAACAGGAGTTAAAAATGG + Intergenic
1019105976 6:169667424-169667446 TTGGAAACAAAAATGAAACAAGG + Intronic
1019854599 7:3591959-3591981 CCGGATACAGATGACAAACAAGG + Intronic
1020488662 7:8750985-8751007 CTGAAAACAGAAGAGAAAAATGG - Intronic
1021631664 7:22653120-22653142 CTGGAAACTGAGGTCCAAAAAGG + Intergenic
1022069117 7:26893533-26893555 AATAAAACAGAAGTCAAACATGG - Intronic
1022188162 7:27989411-27989433 ATGGCAACAAAAGTCAAAAATGG + Intronic
1022351925 7:29574397-29574419 CTAGAAACAGAAGAAAGACAAGG + Intergenic
1022539557 7:31123331-31123353 CTCTAAAAAGAAGGCAAACAGGG + Intergenic
1024086245 7:45894107-45894129 ATGGAAACAGAAGTGACAAAAGG - Intergenic
1024840511 7:53581122-53581144 CTGGAAATATAATTAAAACAAGG + Intergenic
1025619686 7:63157267-63157289 CTTGAAAAAGAAGACAAGCAGGG + Intergenic
1026015677 7:66669116-66669138 CTGGAAAACCAAGTCACACAAGG - Intronic
1026222464 7:68412441-68412463 CTGTCAACAGAAGAAAAACAAGG + Intergenic
1026415824 7:70179501-70179523 ATGGACACAGAAGTCAGACATGG - Intronic
1028366381 7:90037394-90037416 CAGAAAACAGAAGTCAAGCAAGG - Intergenic
1028482812 7:91326224-91326246 CTGGAAATAGAAATCAAAAGTGG - Intergenic
1028518825 7:91706830-91706852 CTGTAAATAGAAGTCCTACATGG + Intronic
1028767089 7:94571616-94571638 CTGGAAACAGAACTCACAAATGG + Intergenic
1028774269 7:94659828-94659850 CTGGAAACACAATTCTTACATGG - Intronic
1029945915 7:104532658-104532680 CTGGAAACAAAAGCCAAGAAGGG + Intronic
1030992433 7:116316489-116316511 TTGGGAACACAAGTCAAAGAAGG + Intronic
1033163010 7:139013799-139013821 CTGAGCACAGAAGGCAAACAGGG + Intergenic
1033394621 7:140961788-140961810 GGAGAAACAGAAGTCAACCAGGG + Intergenic
1034172653 7:149074539-149074561 CTGCACAGAGAAGTCAGACAGGG + Intronic
1034357704 7:150465571-150465593 CTCAAAACATATGTCAAACAAGG + Intronic
1036294861 8:7527597-7527619 CTGGAAGCAGAACTCTCACATGG - Intergenic
1036296496 8:7542177-7542199 CTGGAAGCAGAACTCTCACATGG - Exonic
1036326070 8:7778842-7778864 CTGGAAGCAGAACTCTCACATGG + Exonic
1036327702 8:7793394-7793416 CTGGAAGCAGAACTCTCACATGG + Intergenic
1040663643 8:49604606-49604628 CAGGAGACAGCAGGCAAACAGGG - Intergenic
1041349209 8:56931681-56931703 CTGAAAACAGAAAGCAAACTGGG + Intergenic
1041644863 8:60240943-60240965 CTGGAAAAAGAAGGAAAAAAAGG + Intronic
1041834303 8:62194714-62194736 CAGGACACAGAAGTCAGAAAGGG + Intergenic
1042444558 8:68868995-68869017 ATGGAAATTGAAGTCACACATGG - Intergenic
1043174140 8:77002696-77002718 CTGTAGTCAGAAGTCCAACATGG + Intergenic
1043283173 8:78495033-78495055 CTGGAATCAGAAGTCAAGTTAGG + Intergenic
1043828455 8:84958610-84958632 CTGATAAAAGAAGTCAAAGAAGG + Intergenic
1044060666 8:87631298-87631320 ATGGAAACAGCAGTTAAACCTGG - Intergenic
1044374315 8:91451324-91451346 CTGGAACTTAAAGTCAAACATGG - Intergenic
1044688352 8:94850820-94850842 ATGGAAAAAAAAATCAAACAAGG - Intronic
1045706928 8:104934935-104934957 GAGGAAACACAAGTCATACATGG + Intronic
1046392413 8:113592718-113592740 GGGGAAACAGAAGTCAAAATTGG - Intergenic
1046490606 8:114948039-114948061 TTGGAAACAAGAATCAAACAAGG + Intergenic
1047102785 8:121696497-121696519 CTGGAATTAGAAGTATAACAAGG - Intergenic
1047103603 8:121708436-121708458 CTGTTAACAGAATGCAAACAGGG + Intergenic
1047317299 8:123746288-123746310 ATGGCAACAAAAGCCAAACAAGG - Intergenic
1047375687 8:124294046-124294068 GGGGAAATAAAAGTCAAACACGG - Intergenic
1048813797 8:138312268-138312290 CTGGAAACAGAAGTCATAGCAGG - Intronic
1050276144 9:4002730-4002752 CTGGAAACATGAGGCATACATGG + Intronic
1050775561 9:9255861-9255883 CTGAATCCTGAAGTCAAACAAGG - Intronic
1051557612 9:18402607-18402629 CTGGAAACAGAGGGCAAGAAAGG - Intergenic
1053395780 9:37772883-37772905 CTCAATACAGAATTCAAACAAGG - Intronic
1055403757 9:75952395-75952417 GTGGAAACAAAAAGCAAACAAGG - Intronic
1055535762 9:77242000-77242022 CAGGAAACAGAAGACAAAGATGG - Intronic
1056803620 9:89711421-89711443 CTGGAAGCAGAGCTCAAGCATGG - Intergenic
1056843868 9:90020550-90020572 CAGGAATCAGAATTCAAAGATGG + Intergenic
1058271567 9:102978117-102978139 CTGGAAACAAAATTAAAACTTGG + Intergenic
1059376159 9:113883238-113883260 CTGGAATAATAAGTCCAACAGGG + Intronic
1060062630 9:120474774-120474796 CTGGAAAGGGAAGTCAAGAAGGG - Intronic
1061004625 9:127921523-127921545 CTGGAACCAGGACTCAACCATGG - Exonic
1062018483 9:134304389-134304411 CAGGAAAAAGAAGTCAGACGTGG - Intergenic
1185779843 X:2834717-2834739 CTGGAGGCAGAAGACAAAGAAGG - Intronic
1187341900 X:18428189-18428211 CTGGACACAGTGGTGAAACAAGG - Intronic
1188366876 X:29326890-29326912 ATGGAAGCAGAAGGAAAACATGG - Intronic
1190446910 X:50535035-50535057 TTGGAAACAAAAGACAAATATGG - Intergenic
1190770361 X:53509031-53509053 ATGAAAACAGAAGAAAAACAAGG - Intergenic
1191226964 X:58054078-58054100 CTGGAAACTGCAGCCAGACATGG + Intergenic
1191692182 X:63952040-63952062 CTGGAATCAGAAGTAAAACAGGG - Intergenic
1191982230 X:66938975-66938997 ATGGATAAAGAAGACAAACATGG + Intergenic
1192408697 X:70912980-70913002 CTGGAAACCCAAATCAAAAAGGG + Intergenic
1192785585 X:74331736-74331758 CGGGAAAAAGAAGGAAAACAGGG + Intergenic
1194108928 X:89806846-89806868 CTGTAAACAGATGTGTAACAAGG + Intergenic
1195349181 X:103980722-103980744 CTGAAAACTGAAGTCACAAAAGG + Intergenic
1195358262 X:104058117-104058139 CTGAAAACTGAAGTCACAAAAGG - Intergenic
1197841602 X:130753635-130753657 CTGGAAATAAAAGTCAGGCATGG - Intronic
1198004435 X:132478222-132478244 CTGGGAACAAAAGCCAAAAACGG - Intronic
1198122959 X:133612178-133612200 CTAGAAACAGAAGTCAAGCTGGG - Intronic
1198280785 X:135139971-135139993 CTGATATCAGAAGTGAAACAGGG - Intergenic
1198290174 X:135232543-135232565 CTGATATCAGAAGTGAAACAGGG + Intergenic
1199005296 X:142689062-142689084 CTGGAAAGAGTACTAAAACAAGG - Intergenic
1199299638 X:146197800-146197822 AAGGAGACAGAAGTCAGACAGGG + Intergenic
1199474128 X:148227473-148227495 CTGGAAACAGATTTGAAGCAAGG - Intergenic
1199860482 X:151796728-151796750 CTGCAAACAGCAGACAAACAAGG - Intergenic
1199975939 X:152894985-152895007 CTGGGAAGAGAACTCAAGCAAGG - Intergenic
1200461585 Y:3461581-3461603 CTGTAAACAGATGTGTAACAAGG + Intergenic
1201290205 Y:12415274-12415296 CTGGAAGCAGAAGACAAAGAAGG + Intergenic
1201459031 Y:14201915-14201937 CTGGAAATAGAGGTTATACAAGG - Intergenic
1201739355 Y:17306901-17306923 CTGCTAACAGAAGTCAATCGTGG - Intergenic
1201757758 Y:17505368-17505390 CTAGACTCAGAAGTCACACATGG + Intergenic
1201843796 Y:18400614-18400636 CTAGACTCAGAAGTCACACATGG - Intergenic