ID: 964470977

View in Genome Browser
Species Human (GRCh38)
Location 3:157055388-157055410
Sequence GCTTTTAATGGGATATTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964470977_964470987 29 Left 964470977 3:157055388-157055410 CCTTCCAATATCCCATTAAAAGC No data
Right 964470987 3:157055440-157055462 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
964470977_964470985 1 Left 964470977 3:157055388-157055410 CCTTCCAATATCCCATTAAAAGC No data
Right 964470985 3:157055412-157055434 CTGTGATGGGTCAGGTGTGGTGG No data
964470977_964470986 28 Left 964470977 3:157055388-157055410 CCTTCCAATATCCCATTAAAAGC No data
Right 964470986 3:157055439-157055461 TGCCTGTAATCCCAGCACTTTGG 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
964470977_964470984 -2 Left 964470977 3:157055388-157055410 CCTTCCAATATCCCATTAAAAGC No data
Right 964470984 3:157055409-157055431 GCTCTGTGATGGGTCAGGTGTGG No data
964470977_964470983 -7 Left 964470977 3:157055388-157055410 CCTTCCAATATCCCATTAAAAGC No data
Right 964470983 3:157055404-157055426 TAAAAGCTCTGTGATGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964470977 Original CRISPR GCTTTTAATGGGATATTGGA AGG (reversed) Intergenic
No off target data available for this crispr