ID: 964472670

View in Genome Browser
Species Human (GRCh38)
Location 3:157071146-157071168
Sequence CAGGATCAGCTTGAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964472670_964472674 -9 Left 964472670 3:157071146-157071168 CCCTCTTCCTCAAGCTGATCCTG No data
Right 964472674 3:157071160-157071182 CTGATCCTGGCAAACAGATGTGG No data
964472670_964472680 26 Left 964472670 3:157071146-157071168 CCCTCTTCCTCAAGCTGATCCTG No data
Right 964472680 3:157071195-157071217 CCATTGCTCCTTGGAGTTGGAGG No data
964472670_964472678 23 Left 964472670 3:157071146-157071168 CCCTCTTCCTCAAGCTGATCCTG No data
Right 964472678 3:157071192-157071214 TGACCATTGCTCCTTGGAGTTGG No data
964472670_964472677 17 Left 964472670 3:157071146-157071168 CCCTCTTCCTCAAGCTGATCCTG No data
Right 964472677 3:157071186-157071208 CAACTCTGACCATTGCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964472670 Original CRISPR CAGGATCAGCTTGAGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr