ID: 964473249

View in Genome Browser
Species Human (GRCh38)
Location 3:157076276-157076298
Sequence CAGGACCCAGAAGATGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964473242_964473249 -1 Left 964473242 3:157076254-157076276 CCCAGCAGAGATGTGCTCTGGCC No data
Right 964473249 3:157076276-157076298 CAGGACCCAGAAGATGGGCAGGG No data
964473239_964473249 18 Left 964473239 3:157076235-157076257 CCTGAGGATCTGCTGCCAGCCCA No data
Right 964473249 3:157076276-157076298 CAGGACCCAGAAGATGGGCAGGG No data
964473238_964473249 24 Left 964473238 3:157076229-157076251 CCACATCCTGAGGATCTGCTGCC No data
Right 964473249 3:157076276-157076298 CAGGACCCAGAAGATGGGCAGGG No data
964473243_964473249 -2 Left 964473243 3:157076255-157076277 CCAGCAGAGATGTGCTCTGGCCA No data
Right 964473249 3:157076276-157076298 CAGGACCCAGAAGATGGGCAGGG No data
964473240_964473249 3 Left 964473240 3:157076250-157076272 CCAGCCCAGCAGAGATGTGCTCT No data
Right 964473249 3:157076276-157076298 CAGGACCCAGAAGATGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964473249 Original CRISPR CAGGACCCAGAAGATGGGCA GGG Intergenic
No off target data available for this crispr