ID: 964473707

View in Genome Browser
Species Human (GRCh38)
Location 3:157080000-157080022
Sequence CCGGCTGCTGACCTTTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964473707_964473709 -10 Left 964473707 3:157080000-157080022 CCAGCAGAAAGGTCAGCAGCCGG No data
Right 964473709 3:157080013-157080035 CAGCAGCCGGAAACAGAAAGAGG No data
964473707_964473711 -4 Left 964473707 3:157080000-157080022 CCAGCAGAAAGGTCAGCAGCCGG No data
Right 964473711 3:157080019-157080041 CCGGAAACAGAAAGAGGAGAAGG No data
964473707_964473712 -3 Left 964473707 3:157080000-157080022 CCAGCAGAAAGGTCAGCAGCCGG No data
Right 964473712 3:157080020-157080042 CGGAAACAGAAAGAGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964473707 Original CRISPR CCGGCTGCTGACCTTTCTGC TGG (reversed) Intergenic
No off target data available for this crispr