ID: 964473709

View in Genome Browser
Species Human (GRCh38)
Location 3:157080013-157080035
Sequence CAGCAGCCGGAAACAGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964473702_964473709 19 Left 964473702 3:157079971-157079993 CCCTGTGAGTGTTCTCCTCCAAC No data
Right 964473709 3:157080013-157080035 CAGCAGCCGGAAACAGAAAGAGG No data
964473707_964473709 -10 Left 964473707 3:157080000-157080022 CCAGCAGAAAGGTCAGCAGCCGG No data
Right 964473709 3:157080013-157080035 CAGCAGCCGGAAACAGAAAGAGG No data
964473703_964473709 18 Left 964473703 3:157079972-157079994 CCTGTGAGTGTTCTCCTCCAACA No data
Right 964473709 3:157080013-157080035 CAGCAGCCGGAAACAGAAAGAGG No data
964473704_964473709 4 Left 964473704 3:157079986-157080008 CCTCCAACAATGAACCAGCAGAA No data
Right 964473709 3:157080013-157080035 CAGCAGCCGGAAACAGAAAGAGG No data
964473705_964473709 1 Left 964473705 3:157079989-157080011 CCAACAATGAACCAGCAGAAAGG No data
Right 964473709 3:157080013-157080035 CAGCAGCCGGAAACAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964473709 Original CRISPR CAGCAGCCGGAAACAGAAAG AGG Intergenic
No off target data available for this crispr