ID: 964473711

View in Genome Browser
Species Human (GRCh38)
Location 3:157080019-157080041
Sequence CCGGAAACAGAAAGAGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964473705_964473711 7 Left 964473705 3:157079989-157080011 CCAACAATGAACCAGCAGAAAGG No data
Right 964473711 3:157080019-157080041 CCGGAAACAGAAAGAGGAGAAGG No data
964473703_964473711 24 Left 964473703 3:157079972-157079994 CCTGTGAGTGTTCTCCTCCAACA No data
Right 964473711 3:157080019-157080041 CCGGAAACAGAAAGAGGAGAAGG No data
964473707_964473711 -4 Left 964473707 3:157080000-157080022 CCAGCAGAAAGGTCAGCAGCCGG No data
Right 964473711 3:157080019-157080041 CCGGAAACAGAAAGAGGAGAAGG No data
964473702_964473711 25 Left 964473702 3:157079971-157079993 CCCTGTGAGTGTTCTCCTCCAAC No data
Right 964473711 3:157080019-157080041 CCGGAAACAGAAAGAGGAGAAGG No data
964473704_964473711 10 Left 964473704 3:157079986-157080008 CCTCCAACAATGAACCAGCAGAA No data
Right 964473711 3:157080019-157080041 CCGGAAACAGAAAGAGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964473711 Original CRISPR CCGGAAACAGAAAGAGGAGA AGG Intergenic
No off target data available for this crispr