ID: 964473962

View in Genome Browser
Species Human (GRCh38)
Location 3:157082267-157082289
Sequence TGTACTCTTCAAAACACAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964473962_964473966 24 Left 964473962 3:157082267-157082289 CCCCTTGTGTTTTGAAGAGTACA 0: 1
1: 0
2: 2
3: 18
4: 171
Right 964473966 3:157082314-157082336 TCAGAAACCAGCTAGAAGCCAGG 0: 1
1: 0
2: 5
3: 22
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964473962 Original CRISPR TGTACTCTTCAAAACACAAG GGG (reversed) Intergenic
901304314 1:8221642-8221664 TGAACTATGCAAAACACACGAGG - Intergenic
901602277 1:10431352-10431374 TGAACTTCTCAAAAGACAAGGGG - Intronic
902388635 1:16090029-16090051 TGTTATGTTCAAAAGACAAGAGG - Intergenic
910356188 1:86359120-86359142 TGTAGTCTTCAAAGCTCAAGTGG - Intronic
910361969 1:86422002-86422024 TGTATTCTTAAAATCACAAGAGG + Intergenic
911363040 1:96902846-96902868 TGTACACTTAAAAATACAATAGG + Intergenic
914964719 1:152245272-152245294 CGTACTCTGCAAAACACTACTGG - Intergenic
917500339 1:175579634-175579656 TGTACTCCTCAAAACCTCAGTGG - Intronic
918068671 1:181119149-181119171 TGCACTCCTCAAAACTCAATAGG - Intergenic
918619307 1:186584038-186584060 TGTACCCTTCAAAGCCAAAGGGG + Intergenic
918777020 1:188645685-188645707 TGTACTGTTCAAAACACATGGGG - Intergenic
920530765 1:206700636-206700658 TGTACATTTCCAAACACAACTGG - Intronic
920854301 1:209650908-209650930 GGTACTTACCAAAACACAAGAGG + Exonic
921772975 1:219064996-219065018 TGTAGCCTTCAAAAAACAAGAGG + Intergenic
922115317 1:222607712-222607734 TGTACTCTGCAAAGCAAGAGGGG - Intergenic
923523076 1:234751081-234751103 TGTCCTCCTCTAAACACAGGGGG + Intergenic
1063941418 10:11134097-11134119 TATACTCTTCTAAAGAGAAGAGG + Intronic
1067973476 10:50996995-50997017 TGTCCTCTTCAAATCACATCTGG - Intronic
1068721625 10:60252200-60252222 TATATTCTTCAAACCACCAGAGG + Intronic
1069061511 10:63899641-63899663 TGGGCTCTTGAAAACATAAGAGG + Intergenic
1069463631 10:68618110-68618132 TTTACTCTTAAAAACTCAAGAGG - Intronic
1070597296 10:77841471-77841493 GGTGCTCTTCCAGACACAAGAGG + Intronic
1073462219 10:103672414-103672436 GGTAGTCTCCATAACACAAGGGG + Intronic
1073522407 10:104145626-104145648 AATACTCTTCAAAATACAGGTGG + Intronic
1078591546 11:12645036-12645058 TGCTCTCTTAAAACCACAAGAGG + Intergenic
1081273849 11:41122232-41122254 TTAACTCTTCAAAATACAATAGG + Intronic
1083958013 11:65997350-65997372 GATAGTCTCCAAAACACAAGAGG + Exonic
1092752375 12:11730722-11730744 TGTACACTCCAAAGCAAAAGAGG - Intronic
1093852243 12:24054689-24054711 ATTTCTCTTCAAAACATAAGTGG + Intergenic
1099824185 12:87753815-87753837 TGTATTTTTCAAAACATCAGAGG + Intergenic
1101050153 12:100854326-100854348 TGCACTCTTCCAAAGAAAAGAGG - Intronic
1101187093 12:102291189-102291211 TGTACCCTTCAAAACCACAGGGG + Intergenic
1101444559 12:104728470-104728492 TGTTCTCTTTAAAAAGCAAGGGG + Intronic
1108606857 13:52047976-52047998 ATTCCTCTTGAAAACACAAGAGG + Intronic
1108891903 13:55272304-55272326 TGTCCTCTCCAAAACTCATGTGG + Intergenic
1109125250 13:58509357-58509379 AGTACTCTTCAAAACTCTAAAGG + Intergenic
1109436091 13:62304919-62304941 GGTCCTCTCCAAAACAGAAGTGG + Intergenic
1111292983 13:86191529-86191551 TAAACTCTTCAAAAAACAAACGG + Intergenic
1118594673 14:67426464-67426486 TGTGCCCCTTAAAACACAAGTGG + Intergenic
1118996443 14:70840734-70840756 TGTCCTCTCCAAAACTCATGTGG - Intergenic
1119332812 14:73807788-73807810 AGTACTCTTCAAAACTCAGAAGG + Intergenic
1119970702 14:78966928-78966950 TGTACACTACAAAACATAAGGGG - Intronic
1120312041 14:82841391-82841413 TGTACCCTCCAAAACTCACGTGG + Intergenic
1127236862 15:57062919-57062941 TGGAGTCTTCAAAACAGAAGAGG + Intronic
1127303055 15:57676600-57676622 TGTATTTTTCAAAAGCCAAGTGG + Intronic
1127536703 15:59896600-59896622 TGATCTCTTCAAGACACAGGAGG - Intergenic
1128562944 15:68680497-68680519 TGTACACTGCACAACTCAAGGGG - Intronic
1136464462 16:30432718-30432740 TGTAGTCTTAACTACACAAGTGG - Intergenic
1137496924 16:48977173-48977195 AGTACTCTGCAGAACACTAGAGG + Intergenic
1137641482 16:50034588-50034610 TCTACTTTTAAAAACACAATAGG - Intronic
1138878780 16:60985215-60985237 TGGACTCTTCAAAACAGATATGG + Intergenic
1140291672 16:73665023-73665045 TGCACTCTTCAGCAGACAAGAGG - Intergenic
1142014004 16:87734042-87734064 GGTACCCTAAAAAACACAAGAGG + Intronic
1143297813 17:5884249-5884271 TGAACACTGCAAAACACATGGGG - Intronic
1144419024 17:15078986-15079008 TGTACTCTACAAGGCACCAGGGG + Intergenic
1144496212 17:15747227-15747249 GGTGCTCTCCAAACCACAAGGGG + Intronic
1154006416 18:10532107-10532129 TGTAATCATCAAAACAAAACAGG - Intronic
1154081339 18:11259999-11260021 TGTAATCTGAAAAACAAAAGTGG - Intergenic
1156731281 18:40196326-40196348 TGTAAGCATCAAAAGACAAGGGG + Intergenic
1157092920 18:44657818-44657840 TATACTATTCAGAAAACAAGAGG - Intergenic
1157137183 18:45067716-45067738 TGAACTCTCCAAGAAACAAGAGG - Exonic
1158601694 18:58861783-58861805 TGTACTCTTCAATGCACATACGG + Intergenic
1159051725 18:63426673-63426695 TCTATTCTTCAAAGCCCAAGAGG - Intergenic
1159215625 18:65387313-65387335 TGTACCCTTCAAAGCCAAAGGGG + Intergenic
1159300920 18:66566604-66566626 TGTACTTATCAAAAAACCAGGGG + Intronic
1160956514 19:1695105-1695127 TGCAATCTCCAAAACACAAATGG + Intergenic
1161951881 19:7472028-7472050 TGTTCTCTTCACAACAGAACAGG - Exonic
927389868 2:22582801-22582823 TGTACCCTGCAAAACCAAAGGGG + Intergenic
929307227 2:40377292-40377314 GGTCCTCTTCAAAACTCATGTGG - Intronic
930326265 2:49922718-49922740 TGTATTCTTTAAAATACAAGGGG - Intronic
931741781 2:65252257-65252279 TGTACTCTTTTAAAAAGAAGAGG - Intronic
932286946 2:70542708-70542730 TATACTCTCCAAATCAGAAGTGG + Intronic
933207191 2:79520535-79520557 TTTGCTCTTCAAAAGACAAAAGG + Intronic
933910611 2:86937831-86937853 TGTAGTTTTAAAAACAAAAGAGG + Intronic
934022117 2:87965571-87965593 TGTAGTTTTAAAAACAAAAGAGG - Intergenic
936685456 2:114821881-114821903 TGTACTCTGCAAAACCACAGGGG - Intronic
938986300 2:136579680-136579702 TGTACTTTTCAAAACCAAAAAGG + Intergenic
939119616 2:138100740-138100762 TGCTCTCTGCAAAACCCAAGTGG - Intergenic
941202184 2:162525749-162525771 TGGACTGTTCCAAACACAAATGG + Intronic
942440895 2:176035348-176035370 TGCACTCTTCAAAACACAAAAGG + Intergenic
942495297 2:176533840-176533862 AGGACTCTTTAAAACATAAGGGG + Intergenic
942974045 2:181993129-181993151 TGAATTGTTCAAAACGCAAGGGG + Intronic
943015153 2:182501490-182501512 CTTTCTCTTCAAAACAGAAGAGG - Intronic
943526117 2:189019766-189019788 AGTACTCTTCTAAACACTATAGG + Intergenic
946407759 2:219501139-219501161 TGTAGTCTTCAATACTCAGGAGG + Intronic
946409552 2:219509308-219509330 TGCACTCCCCAAAACACAAAGGG + Intergenic
947677357 2:231994637-231994659 TGTAATTTTAAAAACTCAAGAGG + Intronic
948132237 2:235609272-235609294 TGTTCTCTTCCAAGCACCAGTGG - Intronic
1169619038 20:7483977-7483999 TGTAACCCTCAAAACACATGTGG + Intergenic
1171191130 20:23160584-23160606 TGAATTCTTCAAAACAAAAGAGG + Intergenic
1171749860 20:29038439-29038461 TGTACTCTTCAAAGCAATAGGGG - Intergenic
1174870986 20:54181929-54181951 AGTATTCTTCAAATCGCAAGAGG - Intergenic
1174942859 20:54950127-54950149 TATACTTTTCAAAACAAAAATGG - Intergenic
1177847998 21:26314038-26314060 TCTTCTCTTCAAAACAGAGGTGG - Intergenic
1178267185 21:31154421-31154443 TGTACTCTTCGGAGCACAGGGGG + Exonic
1183035219 22:35136001-35136023 TGTGCTCTTCAAGACACACTGGG - Intergenic
1183969499 22:41466172-41466194 TGTTTTCTTCAAAAAACAAAAGG - Intronic
949804984 3:7944882-7944904 AGTACTCTGCCAAAAACAAGAGG + Intergenic
951409416 3:22344127-22344149 AAAATTCTTCAAAACACAAGAGG - Intronic
954352853 3:50059782-50059804 TTTCCTCTCAAAAACACAAGTGG - Intronic
957137141 3:76303599-76303621 ACTACTCTTCAAAAAAAAAGAGG + Intronic
957840279 3:85659512-85659534 AGTAATCTGCAAAATACAAGGGG + Intronic
958469777 3:94502756-94502778 TGTACCCTGCAAAGCACCAGGGG - Intergenic
959527895 3:107398009-107398031 CTCACTCTTCAAGACACAAGAGG + Intergenic
961160117 3:124716834-124716856 AGTACTTTGCAAAACACATGTGG + Intronic
961413730 3:126742487-126742509 TGTCCCCTTCAAAACTCATGTGG + Intronic
962445788 3:135463013-135463035 TGAAATTTTCAAAACCCAAGAGG + Intergenic
964473962 3:157082267-157082289 TGTACTCTTCAAAACACAAGGGG - Intergenic
967899418 3:194434052-194434074 TGAACTCTTGAACACACACGTGG - Intronic
968788920 4:2645966-2645988 TTTACTCTTGAAAATACAACTGG - Intronic
970209042 4:13688215-13688237 TCTAGTGTTCAAAACACAATAGG - Intergenic
972886292 4:43493417-43493439 TGTACTAATAAAAACATAAGTGG - Intergenic
973256155 4:48115731-48115753 TGTAGTCTTCAATACTCAGGAGG + Intronic
973663585 4:53134302-53134324 TGTACACTTCAAAACTTAAGAGG + Intronic
977568446 4:98606320-98606342 TGTACTTTTCAAAAGAAAACAGG + Intronic
977867107 4:102042450-102042472 TGTGCTCTTTTAAACAGAAGAGG - Intronic
977910164 4:102525018-102525040 AGTACTCTGCATAACACAAGGGG - Intronic
979377623 4:119965642-119965664 GGTACACTTCAAAACTGAAGAGG + Intergenic
979472598 4:121118261-121118283 TGTAATCTTCAAAACACCCAAGG + Intergenic
979935674 4:126691150-126691172 TGTACCCTTCAAAATTCATGTGG - Intergenic
980398809 4:132252465-132252487 TGTAATCTTTAAAAGAGAAGTGG - Intergenic
982609147 4:157551556-157551578 TGTACTCTGCAAAACCATAGGGG + Intergenic
986788138 5:11134071-11134093 GGAACTCTTCAAATCAGAAGAGG + Intronic
987112936 5:14703610-14703632 GGTACTCTTAATACCACAAGGGG - Intergenic
987868215 5:23574184-23574206 AGCACTCTTCTAAACCCAAGTGG - Intergenic
990132092 5:52598137-52598159 TGTCCTCATCAATACACGAGCGG - Intergenic
992481940 5:77159819-77159841 TGCACCCTTCAAAAGACCAGAGG - Intergenic
994469790 5:100188408-100188430 TGTGCTATTCAAAGGACAAGTGG - Intergenic
996298643 5:121954692-121954714 TCTACTCTTCAAAAGACACTGGG - Intergenic
997672832 5:135690521-135690543 TAAACCCTGCAAAACACAAGTGG - Intergenic
998753960 5:145355214-145355236 TGGAAACTTCAAAATACAAGGGG + Intergenic
1000537957 5:162503053-162503075 AGTACTCTTAACAACACATGTGG + Intergenic
1001731106 5:173959443-173959465 TCAACTCTTCAAAACAAAAGGGG - Exonic
1004219515 6:13733885-13733907 TCTACTCTCAAACACACAAGCGG + Intergenic
1006603468 6:35240942-35240964 TGTACACTTAAAAACTTAAGAGG - Intronic
1007657440 6:43459713-43459735 TAAAATCTTCAAAGCACAAGGGG - Intergenic
1007862352 6:44925041-44925063 TGAACTTTTAAAAACAAAAGTGG - Intronic
1009747508 6:67836960-67836982 TATACTCCTCCAAACATAAGAGG - Intergenic
1009772532 6:68161442-68161464 TGTACTCTGCAAAACCACAGAGG + Intergenic
1010373162 6:75135139-75135161 AGAACTCTTCAAAAAAAAAGGGG + Intronic
1013849387 6:114495621-114495643 CCCACTCTTCAGAACACAAGAGG + Intergenic
1014650662 6:124032628-124032650 GGTACTCTTAAATTCACAAGTGG + Intronic
1014857234 6:126417051-126417073 TGTACTCTTCAAAGCCACAGGGG + Intergenic
1017092024 6:150767934-150767956 TGAACTCTTTAGCACACAAGGGG + Intronic
1018618035 6:165706430-165706452 TGTATTCATCAGAACACAAATGG - Intronic
1021873369 7:25025851-25025873 TGCACTCACCAAAACATAAGAGG - Intergenic
1021944625 7:25714577-25714599 TGTCCTCTTTAACACACCAGGGG - Intergenic
1023914315 7:44577163-44577185 TTTACTCTTAAAAATACATGTGG - Intergenic
1024015019 7:45305807-45305829 TGTATTCTTTAATACAGAAGGGG - Intergenic
1024490798 7:49983763-49983785 TGTATTATTCAAAATACAAAGGG - Intronic
1024505840 7:50160577-50160599 TGTTCTCAGCAAAACACAAATGG + Intergenic
1025167705 7:56727468-56727490 TTTACTCTTAAAAACTCAAGAGG + Intergenic
1028011330 7:85648473-85648495 TGTACCCTACAAAACAACAGGGG - Intergenic
1028189220 7:87825702-87825724 TGTACTCTGCAAAACCACAGGGG + Intronic
1028632452 7:92949790-92949812 TTTAATCTTCAAATCACAAGAGG - Intergenic
1028995189 7:97092416-97092438 TGTACTCTGCAATACAAGAGGGG + Intergenic
1029346955 7:99985685-99985707 TGCACTCTTCACAACTCAATAGG - Intergenic
1029415468 7:100440430-100440452 TTTCCTCTTCAAAAGAAAAGGGG + Intergenic
1030693618 7:112560228-112560250 AGCATTATTCAAAACACAAGTGG + Intergenic
1032054631 7:128674595-128674617 TATCCTCTGCAAAACACAAAGGG - Intronic
1032948061 7:136874231-136874253 TATACTTTTCAAAGCACATGTGG - Intronic
1033922834 7:146415950-146415972 TGTACTCTTTAAAATACAATTGG - Intronic
1037792924 8:21963235-21963257 TGTGCTCTTCAGAACACCTGCGG + Intronic
1040851374 8:51904265-51904287 TGTAGTCTAAAAAACACAGGTGG + Intergenic
1041638381 8:60169936-60169958 TGTAGTGTTCAAAAAGCAAGTGG - Intergenic
1042252542 8:66771363-66771385 TGACATTTTCAAAACACAAGGGG + Intronic
1045965614 8:108021498-108021520 TCTCCTCTTCACAACACAGGTGG + Intronic
1046182788 8:110673936-110673958 TGTACACTGCAAAACAGAAATGG + Intergenic
1047044685 8:121038747-121038769 TGGACTATTCATCACACAAGGGG + Intergenic
1048111622 8:131473948-131473970 TGTACTCTGCAAAACAACAGAGG + Intergenic
1048628534 8:136214316-136214338 TATAGTCTTCAAAACAGGAGAGG - Intergenic
1051148100 9:14050889-14050911 TGTACCCTTCGAAACATAATAGG + Intergenic
1051388747 9:16540315-16540337 TATTCTTTTCAATACACAAGTGG - Intronic
1051764453 9:20507227-20507249 TGTAAGCTTCAAAACTTAAGAGG - Intronic
1053356185 9:37447660-37447682 TCTAATCTTCAAAACAACAGTGG + Intronic
1058785529 9:108382952-108382974 AGTAGTCCTCAAAACACATGAGG - Intergenic
1185841338 X:3394541-3394563 TGTCCTCTCCAAAACTCAAGTGG + Intergenic
1188308073 X:28583277-28583299 TTTAGCCTTCAAAACAAAAGGGG + Intergenic
1188819179 X:34752949-34752971 TGTAATCTTCCAAACTCATGTGG + Intergenic
1190836338 X:54104505-54104527 TGTCTTCTTAAAAACACAGGAGG + Intronic
1192011435 X:67277586-67277608 TGGACTCTTCAAAGCCCAAAGGG - Intergenic
1193390011 X:80914710-80914732 TTTACTCTCCAAGACACAAGTGG - Intergenic
1193535248 X:82707253-82707275 TCTCCTCTTCAAAAGACCAGAGG - Intergenic
1194692230 X:97001192-97001214 TGTTCCCTTCACAACACCAGTGG + Intronic
1194723989 X:97373478-97373500 TGTAGTCTTCATAACATAAAAGG - Intronic
1196695684 X:118608828-118608850 TCTACTCTTCAAATTACATGAGG + Intronic
1197173020 X:123455485-123455507 TGACTTCTTCAAAACATAAGTGG + Intronic
1199014378 X:142796011-142796033 TTTAATCTTCACAACATAAGTGG + Intergenic
1199388800 X:147255548-147255570 TGAAAACTTCAACACACAAGTGG - Intergenic
1200836365 Y:7735943-7735965 AGTTCTCCTCAAAACACAATGGG - Intergenic
1201388598 Y:13471543-13471565 TGCACTCTACAAAAAAGAAGGGG + Intronic
1202050203 Y:20772910-20772932 AGTATTCTTTAAAACACAAAAGG - Intronic