ID: 964476378

View in Genome Browser
Species Human (GRCh38)
Location 3:157101279-157101301
Sequence CCTCTGCGACTCCAGGTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964476378_964476384 16 Left 964476378 3:157101279-157101301 CCCCAAACCTGGAGTCGCAGAGG No data
Right 964476384 3:157101318-157101340 ACAGCACAGCTTCTGGTGTCAGG No data
964476378_964476383 9 Left 964476378 3:157101279-157101301 CCCCAAACCTGGAGTCGCAGAGG No data
Right 964476383 3:157101311-157101333 AGCACAGACAGCACAGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964476378 Original CRISPR CCTCTGCGACTCCAGGTTTG GGG (reversed) Intergenic
No off target data available for this crispr