ID: 964479498

View in Genome Browser
Species Human (GRCh38)
Location 3:157127659-157127681
Sequence GATGCTACCCTGCTGCTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964479498_964479501 0 Left 964479498 3:157127659-157127681 CCCGCCAGCAGCAGGGTAGCATC No data
Right 964479501 3:157127682-157127704 TTCAAATTCCTCTCTGACCCTGG No data
964479498_964479508 30 Left 964479498 3:157127659-157127681 CCCGCCAGCAGCAGGGTAGCATC No data
Right 964479508 3:157127712-157127734 GCCTCCTCCTTTCACGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964479498 Original CRISPR GATGCTACCCTGCTGCTGGC GGG (reversed) Intergenic
No off target data available for this crispr