ID: 964481761

View in Genome Browser
Species Human (GRCh38)
Location 3:157145678-157145700
Sequence TCAGTTCTAAAATAACAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964481759_964481761 5 Left 964481759 3:157145650-157145672 CCTGGTGGATGAGGCAGCAACCT 0: 1
1: 0
2: 1
3: 22
4: 149
Right 964481761 3:157145678-157145700 TCAGTTCTAAAATAACAGTCTGG 0: 1
1: 0
2: 1
3: 16
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964481761 Original CRISPR TCAGTTCTAAAATAACAGTC TGG Intergenic
902140702 1:14351263-14351285 TTAATTCTAAAATAATAATCAGG + Intergenic
902358833 1:15930127-15930149 CCTATTCTAACATAACAGTCAGG + Exonic
903632836 1:24789699-24789721 TCAGTTCTAAAATTTCCATCTGG + Intronic
903870534 1:26431353-26431375 TGACTTCTAAAATAACAGAAAGG - Intergenic
905943272 1:41880955-41880977 CTAGTTCTAATATAACACTCTGG + Intronic
906047699 1:42844955-42844977 ACAGTTTTAAAATAAAAGTTTGG + Exonic
907257806 1:53193142-53193164 TAAACTCTAAAATAACAGCCTGG - Intergenic
908979134 1:69932914-69932936 TCAGTTCTGAATCCACAGTCAGG + Intronic
911443233 1:97956143-97956165 TCAGTTATAAATTACCAGACAGG + Intergenic
911515653 1:98865724-98865746 TCATTACTAAAAGAACAGTATGG + Intergenic
916271466 1:162947248-162947270 TCATTTCCAAAATATCACTCTGG - Intergenic
917998700 1:180469184-180469206 TCAAATCTAAAAAAACAATCAGG - Intronic
920902958 1:210130041-210130063 TGAGTTCTGAAATATCTGTCGGG + Intronic
922865374 1:228856206-228856228 ACAGTTCTATAATAATAGTTGGG - Intergenic
924356634 1:243184041-243184063 TCAGTGCTGAAAGAACATTCTGG + Intronic
1070528311 10:77313981-77314003 TCATTTATAAAATGACGGTCAGG - Intronic
1072454644 10:95565048-95565070 TCAGTTCAAAAATTAAAGGCAGG - Intergenic
1073798007 10:107009390-107009412 TCAGTTAAAAAATAAAAATCTGG - Intronic
1074254554 10:111787711-111787733 TCTGTTCAACAATAAAAGTCTGG + Intergenic
1079747288 11:24149651-24149673 TCAGTTCTAAGAAATCAGTTTGG + Intergenic
1086250443 11:84806002-84806024 TCATTTCTAAAATTCCAGTTTGG - Intronic
1087296533 11:96382286-96382308 TCAGTTCAAAAAGAACAATTCGG + Intronic
1090299138 11:125619354-125619376 TCATATATAAAATAACAGGCTGG - Intronic
1090545602 11:127763905-127763927 ACATTTCTAAAATAAAAGCCAGG + Intergenic
1091620099 12:2080697-2080719 TCATTTCTAAAAATACAGTTGGG - Intronic
1091855854 12:3739514-3739536 TCAGTTCTAAGATAAAATTCTGG + Intronic
1092245647 12:6862854-6862876 CGAGTTCTCAAATGACAGTCAGG - Intronic
1094487410 12:30935960-30935982 TGAGTTCTAAAAATACACTCAGG - Intronic
1094542080 12:31370995-31371017 TCAGCTCTAAAAATGCAGTCAGG + Intergenic
1096139166 12:49227943-49227965 CCAGCTCTAAAATGACAGCCTGG + Intronic
1098431899 12:70428590-70428612 TGAGGTCTAAAAAAAGAGTCAGG - Intronic
1098533957 12:71574055-71574077 TCAGTTCTATATTAAAAGGCAGG + Intronic
1099680734 12:85824517-85824539 GCAGTTTAAAAATGACAGTCTGG - Intronic
1102147519 12:110666037-110666059 TCAGTTCTAAAATATCCATCTGG - Intronic
1102723561 12:115038454-115038476 TATGTACTAACATAACAGTCAGG - Intergenic
1103425612 12:120830651-120830673 TCAGTTCTAAGCTTCCAGTCTGG + Intronic
1103726867 12:123001720-123001742 GCATTTTTAAAAAAACAGTCAGG - Intronic
1104197091 12:126551153-126551175 TGTGTTTTAAAATAACATTCTGG + Intergenic
1107526673 13:41239638-41239660 TCAGTTGTATAATATCAGTATGG - Intronic
1108669310 13:52667571-52667593 TCAGTTTAAAAAAAAAAGTCAGG - Intronic
1113252934 13:108474058-108474080 TCATTTCTAAAACAACTGTGAGG + Intergenic
1115431504 14:33324311-33324333 GCAGATTTAAAATGACAGTCGGG + Intronic
1116541167 14:46103729-46103751 TCAATGCAAAAATTACAGTCAGG + Intergenic
1118414195 14:65515599-65515621 TCAGTTACAAAATTAAAGTCAGG + Intronic
1119184276 14:72628332-72628354 TCAGTTTTAAAAAAACAGTGTGG - Intronic
1128098725 15:64979958-64979980 TCAGCTATAAAGTAACAATCAGG + Intronic
1130205392 15:81870646-81870668 ACAGTTCTAAAATGACAATCTGG + Intergenic
1131559940 15:93430813-93430835 TCAGTCCTAAAATGACCGACAGG - Intergenic
1133887884 16:9847786-9847808 ACATTTCTAACATAACAGTAGGG + Intronic
1134866276 16:17610248-17610270 TCAGTTCTCAAATAGCAGCTTGG - Intergenic
1135031038 16:19038917-19038939 TTAGTTCAAAAATAACAGTCAGG - Intronic
1135033253 16:19055920-19055942 TCACTTCTAAATTAAGAGACCGG + Intronic
1136238390 16:28929102-28929124 TCTGTTCTCAAAGAACATTCTGG + Intronic
1137828703 16:51523572-51523594 TCTGTGCTGAAATCACAGTCGGG + Intergenic
1138924549 16:61575521-61575543 TCAGCTCTATTATATCAGTCTGG + Intergenic
1142452039 16:90180473-90180495 TCAGTTTTAAAAAAAAAATCCGG + Intergenic
1146748172 17:35350790-35350812 GAAGTTCAAAAATCACAGTCTGG + Exonic
1146814856 17:35934576-35934598 TCAGTTTACAAATAACAGACAGG + Exonic
1147851186 17:43444359-43444381 TCTGTTCTAAGAAAACAGACAGG + Intergenic
1149649236 17:58266426-58266448 TCAATTCTGAAACAAAAGTCAGG + Intronic
1149963974 17:61143245-61143267 TGAAGGCTAAAATAACAGTCTGG - Intronic
1150110406 17:62494381-62494403 TCAATTTTAAAATAAAATTCTGG - Intronic
1151234155 17:72706479-72706501 TCAATTCTCAAAGAACACTCTGG + Intronic
1151392456 17:73796821-73796843 TCATGTCAAAAATCACAGTCTGG - Intergenic
1151572458 17:74933700-74933722 TCAATTTTTAAATCACAGTCAGG + Exonic
1153053136 18:919194-919216 ACAGATCTAAAATAAGACTCTGG + Intergenic
1153491856 18:5657580-5657602 TCAGTTTTTAAATATCAGACTGG + Intergenic
1156274418 18:35569597-35569619 TCATATCTACAATAAAAGTCTGG + Intergenic
1156640418 18:39088772-39088794 TCACTTTTAAAAGATCAGTCTGG + Intergenic
1157032499 18:43929478-43929500 TCAGTTCTAAGAGGAAAGTCTGG - Intergenic
1157813271 18:50712870-50712892 TGGGTTCTAAAAAAATAGTCTGG - Intronic
1157912293 18:51628250-51628272 GAAGTTCTAAAATAAAAGGCCGG + Intergenic
1158571410 18:58599674-58599696 TCAGTTCCAAAATTATAGTTTGG + Intronic
1159332596 18:67017564-67017586 TCAGTTCTAAAAAACCAGAAGGG + Intergenic
1160397063 18:78580295-78580317 TTAGTCCTAAAACAACAGTGAGG + Intergenic
1163130265 19:15268057-15268079 TCAGTTCTAAACTGAGAGCCTGG + Intronic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1166273650 19:41735204-41735226 TCAGTTCTGAAATCTAAGTCTGG - Intronic
1166578873 19:43874059-43874081 TCAGTTGTGAAATTAAAGTCTGG + Exonic
925162642 2:1696463-1696485 TCAGTTCTAGAATTTCAGTTTGG - Intronic
925364386 2:3301904-3301926 TCACTTCTAAAACAAGGGTCAGG + Intronic
926267079 2:11333254-11333276 TCAGCTCTGAAATAAAAGTCTGG - Intronic
930010047 2:46930101-46930123 TCTGTACTTAAATAACAGTAGGG - Intronic
930681569 2:54262313-54262335 ACACTTTTAAAATAAGAGTCTGG - Intronic
932034685 2:68231301-68231323 TCAGTTCTAAAATTACTATTTGG + Intronic
933080967 2:77985449-77985471 ACAGTTCTAATAAAAAAGTCAGG + Intergenic
936340410 2:111626495-111626517 TCACTTCTAAAATTTCAGTTTGG - Intergenic
937782400 2:125854166-125854188 TCAGTTCTCAAATAACTGCCTGG + Intergenic
938193648 2:129305048-129305070 TCAGTTCTAAAATATCCCTTTGG - Intergenic
939016139 2:136905556-136905578 TTGGTCCTAAATTAACAGTCAGG + Intronic
940218961 2:151331212-151331234 TCAATTCTAAAAAAACAGTTTGG - Intergenic
940316315 2:152331036-152331058 GTACTTATAAAATAACAGTCAGG - Intergenic
940322813 2:152395193-152395215 CCAGTTCTGAAAGAACACTCTGG - Intronic
940325180 2:152417755-152417777 GCAGGTCAAAAATAACAGTCTGG - Intronic
940523207 2:154778480-154778502 TGTGTTCTACAATATCAGTCAGG + Intronic
941697422 2:168568350-168568372 TAGGTTCAAAAATAACAGACTGG - Intronic
941988006 2:171526978-171527000 GCAGTTCTTAAAAAACAGTTGGG + Intronic
942882955 2:180884411-180884433 TCAGTTCCAGAATTTCAGTCTGG - Intergenic
943347420 2:186756197-186756219 TGAGTACTAAAATAAAAGTATGG + Intronic
943683597 2:190793273-190793295 TCACTTGTAAAATGAAAGTCTGG + Intergenic
943789135 2:191912007-191912029 TTAGTCCTAAAATATCACTCTGG + Intergenic
945013276 2:205487425-205487447 TCAGTTAGAAGAGAACAGTCAGG - Intronic
947316983 2:228870549-228870571 TCAGTTCCATTATAACAGTGAGG - Intronic
1173392529 20:42647811-42647833 TCAGAACTAAAAGAACAGTCTGG + Intronic
1174931874 20:54825096-54825118 TCATTTCTAAACTAACACTCAGG + Intergenic
1178694993 21:34785429-34785451 TTAGTTCTATTATATCAGTCAGG + Intergenic
1183223804 22:36535269-36535291 TCATTTCTAAAATATCTGTATGG + Intergenic
1183304910 22:37077438-37077460 GCAGTTCTCAAAGCACAGTCAGG + Intronic
1183911623 22:41083777-41083799 TTTTTTCTAAAATAACATTCAGG - Intergenic
950780090 3:15384169-15384191 TCAGGTCTCAAACAAAAGTCTGG - Exonic
951031721 3:17889938-17889960 TCAGTAGTAAAATAGCACTCTGG + Intronic
956198773 3:66683500-66683522 TCAGTTCTAAAATTACTATTTGG + Intergenic
956259133 3:67317756-67317778 ACTGTTCTAAAAAGACAGTCTGG + Intergenic
957703620 3:83751389-83751411 TCAGTTCTAAAATATCCATTTGG - Intergenic
959656544 3:108812151-108812173 TCAATTCTAAAATTTCAGTTTGG + Intergenic
960211831 3:114977624-114977646 TCAGTACTAAAATATAAATCAGG + Intronic
960323904 3:116271239-116271261 TCAATTTAAAAATAACTGTCTGG + Intronic
964481761 3:157145678-157145700 TCAGTTCTAAAATAACAGTCTGG + Intergenic
966961060 3:184939224-184939246 TCAGTTATAACATAACATTCTGG - Intronic
968344554 3:197990541-197990563 TTAATTCTATAATTACAGTCTGG + Exonic
968793430 4:2685474-2685496 TCAGCTCTAAAAGAACATGCAGG - Intronic
973168888 4:47113868-47113890 TCTGTTGTTAAATAACAGACAGG + Intronic
974274580 4:59701751-59701773 TCAGTTCTAAAACATCATTAAGG - Intergenic
974658098 4:64850999-64851021 TCAGTTTTAAAATAAAAATGAGG + Intergenic
975639634 4:76486883-76486905 TCAGTGCTAAAATAAGAGAAAGG + Intronic
977088919 4:92644649-92644671 TCAATTCTAAAATGACAAACAGG - Intronic
977382746 4:96297127-96297149 TCACTTTTAAAATATCAGTAGGG - Intergenic
979245184 4:118495564-118495586 TCAGTGCTGAAAGAACATTCTGG - Intergenic
981030031 4:140115347-140115369 TCACTTCTAAAATAAAACTATGG + Intronic
983530879 4:168808793-168808815 TCACTACTACAATAACAGTATGG + Intronic
984547422 4:181123490-181123512 TCCGTTCTAAAATAACCAACGGG - Intergenic
985130216 4:186731375-186731397 TCAATTCAAAAATTATAGTCTGG + Intergenic
987457885 5:18169646-18169668 TCATATCTAAAATAAAAGTTGGG + Intergenic
987522875 5:19010000-19010022 TCATTTCCAAAATCACAGCCTGG + Intergenic
988951268 5:36263830-36263852 TCACTTCTTAAATAAAAGTAAGG + Intronic
991455180 5:66796009-66796031 TCAGTGCTGAAATAGCAGTAGGG + Intronic
991594712 5:68290680-68290702 TCAGTTATAAGAAAAGAGTCCGG - Intronic
992021678 5:72631007-72631029 TCAGTTCTAACATGACTGTGAGG - Intergenic
992245636 5:74819655-74819677 TCAGTTGATAAATAACAGTTTGG - Intronic
992847606 5:80768040-80768062 GAATTTCTAAAATAACGGTCCGG - Exonic
993583843 5:89698768-89698790 TCAAGTCTAATTTAACAGTCTGG + Intergenic
993739752 5:91523962-91523984 TCAGTTGTAATATAACAGAAGGG + Intergenic
996061284 5:119036351-119036373 TCAGTTCTAAAGTAATTGTCAGG + Intergenic
996453102 5:123649355-123649377 TCAGTTCTAAAATTTCCATCTGG - Intergenic
997133125 5:131297025-131297047 TAAGTTGTAAAATAAAAGTATGG + Intronic
998673338 5:144378493-144378515 TCATTTCTATAATAAAATTCTGG + Intronic
999146127 5:149396335-149396357 TCTTTTTTAAAAAAACAGTCAGG + Intronic
1000005734 5:157182814-157182836 TCAGTTCACAAATAGCAGTTGGG - Intronic
1000536271 5:162482133-162482155 TCAGTTCAAAAATACCAGAAAGG + Intergenic
1000933556 5:167281420-167281442 TCAGTTTTTAAGTAACAGGCAGG + Intergenic
1001851314 5:174969289-174969311 TCAGCTCTAACAGATCAGTCTGG + Intergenic
1002448449 5:179304518-179304540 TCAGTTCTAAAATTTCCGTTTGG - Intronic
1004177818 6:13355345-13355367 TCAATCCTAGAACAACAGTCTGG - Intergenic
1006328358 6:33371471-33371493 TCAGTTTAAAAATAATAGGCTGG + Intergenic
1006599991 6:35218932-35218954 TCACTTGTAAAATATCAGTAGGG + Intronic
1006754619 6:36404616-36404638 TATACTCTAAAATAACAGTCCGG - Intronic
1009904695 6:69856295-69856317 ACAGTTCTAAAATAACTTCCTGG - Intergenic
1011577714 6:88822472-88822494 TCAGTCCTAAAATAACTTTTAGG - Intronic
1012484915 6:99710619-99710641 TCACTTCTACACTAACAGTGTGG - Intergenic
1013237776 6:108213332-108213354 TAAATTCTGAAATAATAGTCCGG - Intronic
1014292247 6:119572018-119572040 TCAGTTCTAAAATTTCTGTTTGG - Intergenic
1017620866 6:156295356-156295378 TGAGTTCTAAAAAATCAGTAGGG + Intergenic
1020544193 7:9502653-9502675 GCAATTTTAAAATAACAGACTGG + Intergenic
1020546075 7:9533112-9533134 TCAATTCTAAAATCACAAACTGG - Intergenic
1021476762 7:21070504-21070526 TCAGTTCTGAAAAAACATCCAGG - Intergenic
1021586038 7:22209541-22209563 TCAGTATTAAAACAACACTCAGG - Intronic
1022216411 7:28266847-28266869 TCAGTCAGAAAATACCAGTCAGG - Intergenic
1023762036 7:43473581-43473603 ATAGTTGTATAATAACAGTCTGG + Intronic
1024536847 7:50442359-50442381 TCAATTCTAAAATATCTCTCAGG - Intergenic
1024695064 7:51847417-51847439 TCTGTTCTCAAATATCAGCCTGG + Intergenic
1024803577 7:53109431-53109453 ACAGCTCTAAGTTAACAGTCTGG - Intergenic
1026022230 7:66717959-66717981 TCAGTTCTAAAATATCTATTTGG + Intronic
1027764252 7:82320114-82320136 TCAGTTCAGAATTAACAGGCTGG - Intronic
1028681198 7:93534654-93534676 TCAGTTCTATAATCACTGTTAGG - Intronic
1028921678 7:96316765-96316787 GCAGTTCTCAAATAAAAGTCTGG + Intronic
1031315509 7:120253538-120253560 TCCTTTCAAAAATAACAGTGTGG - Intergenic
1035789097 8:2287609-2287631 TCAGTTCTAAAAACGCACTCTGG - Intergenic
1035803708 8:2434096-2434118 TCAGTTCTAAAAACGCACTCTGG + Intergenic
1037392137 8:18404286-18404308 TCAGTTCTATAATTTCTGTCTGG - Intergenic
1038201769 8:25419529-25419551 TAATTTCTAAAATATCAGTCTGG + Intronic
1041244025 8:55874154-55874176 TCAATTCTACAAAAACAGTTTGG - Intergenic
1041373343 8:57188102-57188124 TCAGTACTAAAATAAAATTGAGG + Intergenic
1041492138 8:58444795-58444817 TCAGTTCTAAAATTAGCATCAGG + Intronic
1043459505 8:80445536-80445558 TCACTTCCAAAACTACAGTCAGG - Intergenic
1047016234 8:120726253-120726275 TTAGTGCTAAAATAATATTCAGG - Intronic
1050247660 9:3707974-3707996 TCAGTTGGAAAATAACTGTCTGG - Intergenic
1058586480 9:106512023-106512045 TCAGTTCTAAAATTTTAATCTGG - Intergenic
1059737049 9:117111401-117111423 TCAGTTCTAAAATATCTATTTGG - Intronic
1059799412 9:117735139-117735161 ACAGTCCTAAAAGAGCAGTCAGG + Intergenic
1060430534 9:123547545-123547567 TCATTTAAAAAATTACAGTCAGG - Intronic
1188360029 X:29241847-29241869 TCAGTTCTACAAAAGCAGTTGGG - Intronic
1188739646 X:33762950-33762972 TCAGTTCTAGAATATCTGTTTGG + Intergenic
1189101587 X:38196085-38196107 TCTGTTCTAAAATAACGCTTAGG - Intronic
1189178390 X:38980695-38980717 TCAGGCATATAATAACAGTCAGG - Intergenic
1189953789 X:46258232-46258254 TCAGTTTTATAAATACAGTCTGG + Intergenic
1190022479 X:46891742-46891764 TCTGTTTTAAAATAAAAGTTGGG + Intronic
1190181084 X:48193408-48193430 TCAGATCTAAAATAGCTGTGGGG - Intronic
1190203897 X:48386153-48386175 TCAGATCTAAGATAACTGTGGGG + Intronic
1190206639 X:48409250-48409272 TCAGATCTAAGATAACTGTGGGG - Intronic
1190445907 X:50523827-50523849 TCAGTTCTATAAGGGCAGTCTGG + Intergenic
1194779477 X:98006796-98006818 GCAGTTGTAAAATAAATGTCTGG - Intergenic
1195405036 X:104503341-104503363 TCATTTCTGAAATAACTGCCTGG - Intergenic
1195508895 X:105691239-105691261 TCAATTCTAAAATATCAGCCAGG + Intronic
1195919863 X:109973166-109973188 TTAGTTCTAAAATATCAATTTGG + Intergenic
1201754772 Y:17474927-17474949 TCTGTTTTAAAAGAAGAGTCAGG + Intergenic
1201846780 Y:18431058-18431080 TCTGTTTTAAAAGAAGAGTCAGG - Intergenic