ID: 964487987

View in Genome Browser
Species Human (GRCh38)
Location 3:157205766-157205788
Sequence AGCCAGTCAGAGGGCCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964487987_964487999 29 Left 964487987 3:157205766-157205788 CCCCCAGGGCCCTCTGACTGGCT No data
Right 964487999 3:157205818-157205840 GAGGCCGGCACTCACACTCAGGG No data
964487987_964487994 0 Left 964487987 3:157205766-157205788 CCCCCAGGGCCCTCTGACTGGCT No data
Right 964487994 3:157205789-157205811 CTCACATGTGCTCCAAAAGGTGG No data
964487987_964487997 14 Left 964487987 3:157205766-157205788 CCCCCAGGGCCCTCTGACTGGCT No data
Right 964487997 3:157205803-157205825 AAAAGGTGGACTTGAGAGGCCGG No data
964487987_964487995 10 Left 964487987 3:157205766-157205788 CCCCCAGGGCCCTCTGACTGGCT No data
Right 964487995 3:157205799-157205821 CTCCAAAAGGTGGACTTGAGAGG No data
964487987_964487998 28 Left 964487987 3:157205766-157205788 CCCCCAGGGCCCTCTGACTGGCT No data
Right 964487998 3:157205817-157205839 AGAGGCCGGCACTCACACTCAGG No data
964487987_964487993 -3 Left 964487987 3:157205766-157205788 CCCCCAGGGCCCTCTGACTGGCT No data
Right 964487993 3:157205786-157205808 GCTCTCACATGTGCTCCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964487987 Original CRISPR AGCCAGTCAGAGGGCCCTGG GGG (reversed) Intergenic
No off target data available for this crispr