ID: 964487990

View in Genome Browser
Species Human (GRCh38)
Location 3:157205769-157205791
Sequence GAGAGCCAGTCAGAGGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964487990_964487997 11 Left 964487990 3:157205769-157205791 CCAGGGCCCTCTGACTGGCTCTC No data
Right 964487997 3:157205803-157205825 AAAAGGTGGACTTGAGAGGCCGG No data
964487990_964487998 25 Left 964487990 3:157205769-157205791 CCAGGGCCCTCTGACTGGCTCTC No data
Right 964487998 3:157205817-157205839 AGAGGCCGGCACTCACACTCAGG No data
964487990_964487994 -3 Left 964487990 3:157205769-157205791 CCAGGGCCCTCTGACTGGCTCTC No data
Right 964487994 3:157205789-157205811 CTCACATGTGCTCCAAAAGGTGG No data
964487990_964487993 -6 Left 964487990 3:157205769-157205791 CCAGGGCCCTCTGACTGGCTCTC No data
Right 964487993 3:157205786-157205808 GCTCTCACATGTGCTCCAAAAGG No data
964487990_964487999 26 Left 964487990 3:157205769-157205791 CCAGGGCCCTCTGACTGGCTCTC No data
Right 964487999 3:157205818-157205840 GAGGCCGGCACTCACACTCAGGG No data
964487990_964487995 7 Left 964487990 3:157205769-157205791 CCAGGGCCCTCTGACTGGCTCTC No data
Right 964487995 3:157205799-157205821 CTCCAAAAGGTGGACTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964487990 Original CRISPR GAGAGCCAGTCAGAGGGCCC TGG (reversed) Intergenic
No off target data available for this crispr