ID: 964487991

View in Genome Browser
Species Human (GRCh38)
Location 3:157205775-157205797
Sequence ACATGTGAGAGCCAGTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964487991_964488001 28 Left 964487991 3:157205775-157205797 CCCTCTGACTGGCTCTCACATGT No data
Right 964488001 3:157205826-157205848 CACTCACACTCAGGGTTTTCTGG No data
964487991_964487997 5 Left 964487991 3:157205775-157205797 CCCTCTGACTGGCTCTCACATGT No data
Right 964487997 3:157205803-157205825 AAAAGGTGGACTTGAGAGGCCGG No data
964487991_964487999 20 Left 964487991 3:157205775-157205797 CCCTCTGACTGGCTCTCACATGT No data
Right 964487999 3:157205818-157205840 GAGGCCGGCACTCACACTCAGGG No data
964487991_964487994 -9 Left 964487991 3:157205775-157205797 CCCTCTGACTGGCTCTCACATGT No data
Right 964487994 3:157205789-157205811 CTCACATGTGCTCCAAAAGGTGG No data
964487991_964487995 1 Left 964487991 3:157205775-157205797 CCCTCTGACTGGCTCTCACATGT No data
Right 964487995 3:157205799-157205821 CTCCAAAAGGTGGACTTGAGAGG No data
964487991_964487998 19 Left 964487991 3:157205775-157205797 CCCTCTGACTGGCTCTCACATGT No data
Right 964487998 3:157205817-157205839 AGAGGCCGGCACTCACACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964487991 Original CRISPR ACATGTGAGAGCCAGTCAGA GGG (reversed) Intergenic
No off target data available for this crispr