ID: 964487993

View in Genome Browser
Species Human (GRCh38)
Location 3:157205786-157205808
Sequence GCTCTCACATGTGCTCCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964487983_964487993 25 Left 964487983 3:157205738-157205760 CCATATGGGGGTGTGCAGTGGGA No data
Right 964487993 3:157205786-157205808 GCTCTCACATGTGCTCCAAAAGG No data
964487988_964487993 -4 Left 964487988 3:157205767-157205789 CCCCAGGGCCCTCTGACTGGCTC No data
Right 964487993 3:157205786-157205808 GCTCTCACATGTGCTCCAAAAGG No data
964487987_964487993 -3 Left 964487987 3:157205766-157205788 CCCCCAGGGCCCTCTGACTGGCT No data
Right 964487993 3:157205786-157205808 GCTCTCACATGTGCTCCAAAAGG No data
964487989_964487993 -5 Left 964487989 3:157205768-157205790 CCCAGGGCCCTCTGACTGGCTCT No data
Right 964487993 3:157205786-157205808 GCTCTCACATGTGCTCCAAAAGG No data
964487990_964487993 -6 Left 964487990 3:157205769-157205791 CCAGGGCCCTCTGACTGGCTCTC No data
Right 964487993 3:157205786-157205808 GCTCTCACATGTGCTCCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964487993 Original CRISPR GCTCTCACATGTGCTCCAAA AGG Intergenic
No off target data available for this crispr