ID: 964487997

View in Genome Browser
Species Human (GRCh38)
Location 3:157205803-157205825
Sequence AAAAGGTGGACTTGAGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964487990_964487997 11 Left 964487990 3:157205769-157205791 CCAGGGCCCTCTGACTGGCTCTC No data
Right 964487997 3:157205803-157205825 AAAAGGTGGACTTGAGAGGCCGG No data
964487992_964487997 4 Left 964487992 3:157205776-157205798 CCTCTGACTGGCTCTCACATGTG No data
Right 964487997 3:157205803-157205825 AAAAGGTGGACTTGAGAGGCCGG No data
964487989_964487997 12 Left 964487989 3:157205768-157205790 CCCAGGGCCCTCTGACTGGCTCT No data
Right 964487997 3:157205803-157205825 AAAAGGTGGACTTGAGAGGCCGG No data
964487988_964487997 13 Left 964487988 3:157205767-157205789 CCCCAGGGCCCTCTGACTGGCTC No data
Right 964487997 3:157205803-157205825 AAAAGGTGGACTTGAGAGGCCGG No data
964487987_964487997 14 Left 964487987 3:157205766-157205788 CCCCCAGGGCCCTCTGACTGGCT No data
Right 964487997 3:157205803-157205825 AAAAGGTGGACTTGAGAGGCCGG No data
964487991_964487997 5 Left 964487991 3:157205775-157205797 CCCTCTGACTGGCTCTCACATGT No data
Right 964487997 3:157205803-157205825 AAAAGGTGGACTTGAGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964487997 Original CRISPR AAAAGGTGGACTTGAGAGGC CGG Intergenic
No off target data available for this crispr