ID: 964487998

View in Genome Browser
Species Human (GRCh38)
Location 3:157205817-157205839
Sequence AGAGGCCGGCACTCACACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964487987_964487998 28 Left 964487987 3:157205766-157205788 CCCCCAGGGCCCTCTGACTGGCT No data
Right 964487998 3:157205817-157205839 AGAGGCCGGCACTCACACTCAGG No data
964487988_964487998 27 Left 964487988 3:157205767-157205789 CCCCAGGGCCCTCTGACTGGCTC No data
Right 964487998 3:157205817-157205839 AGAGGCCGGCACTCACACTCAGG No data
964487991_964487998 19 Left 964487991 3:157205775-157205797 CCCTCTGACTGGCTCTCACATGT No data
Right 964487998 3:157205817-157205839 AGAGGCCGGCACTCACACTCAGG No data
964487996_964487998 -7 Left 964487996 3:157205801-157205823 CCAAAAGGTGGACTTGAGAGGCC No data
Right 964487998 3:157205817-157205839 AGAGGCCGGCACTCACACTCAGG No data
964487992_964487998 18 Left 964487992 3:157205776-157205798 CCTCTGACTGGCTCTCACATGTG No data
Right 964487998 3:157205817-157205839 AGAGGCCGGCACTCACACTCAGG No data
964487990_964487998 25 Left 964487990 3:157205769-157205791 CCAGGGCCCTCTGACTGGCTCTC No data
Right 964487998 3:157205817-157205839 AGAGGCCGGCACTCACACTCAGG No data
964487989_964487998 26 Left 964487989 3:157205768-157205790 CCCAGGGCCCTCTGACTGGCTCT No data
Right 964487998 3:157205817-157205839 AGAGGCCGGCACTCACACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964487998 Original CRISPR AGAGGCCGGCACTCACACTC AGG Intergenic
No off target data available for this crispr