ID: 964487999

View in Genome Browser
Species Human (GRCh38)
Location 3:157205818-157205840
Sequence GAGGCCGGCACTCACACTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964487990_964487999 26 Left 964487990 3:157205769-157205791 CCAGGGCCCTCTGACTGGCTCTC No data
Right 964487999 3:157205818-157205840 GAGGCCGGCACTCACACTCAGGG No data
964487996_964487999 -6 Left 964487996 3:157205801-157205823 CCAAAAGGTGGACTTGAGAGGCC No data
Right 964487999 3:157205818-157205840 GAGGCCGGCACTCACACTCAGGG No data
964487988_964487999 28 Left 964487988 3:157205767-157205789 CCCCAGGGCCCTCTGACTGGCTC No data
Right 964487999 3:157205818-157205840 GAGGCCGGCACTCACACTCAGGG No data
964487987_964487999 29 Left 964487987 3:157205766-157205788 CCCCCAGGGCCCTCTGACTGGCT No data
Right 964487999 3:157205818-157205840 GAGGCCGGCACTCACACTCAGGG No data
964487989_964487999 27 Left 964487989 3:157205768-157205790 CCCAGGGCCCTCTGACTGGCTCT No data
Right 964487999 3:157205818-157205840 GAGGCCGGCACTCACACTCAGGG No data
964487992_964487999 19 Left 964487992 3:157205776-157205798 CCTCTGACTGGCTCTCACATGTG No data
Right 964487999 3:157205818-157205840 GAGGCCGGCACTCACACTCAGGG No data
964487991_964487999 20 Left 964487991 3:157205775-157205797 CCCTCTGACTGGCTCTCACATGT No data
Right 964487999 3:157205818-157205840 GAGGCCGGCACTCACACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964487999 Original CRISPR GAGGCCGGCACTCACACTCA GGG Intergenic
No off target data available for this crispr