ID: 964488296

View in Genome Browser
Species Human (GRCh38)
Location 3:157208526-157208548
Sequence TTTGTTTTTTACTTTTGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964488296_964488305 30 Left 964488296 3:157208526-157208548 CCCTGACAAAAGTAAAAAACAAA No data
Right 964488305 3:157208579-157208601 TGGCTTTTGCTTTTGTGATGCGG No data
964488296_964488300 10 Left 964488296 3:157208526-157208548 CCCTGACAAAAGTAAAAAACAAA No data
Right 964488300 3:157208559-157208581 AGAGAGCCCCAAGAATGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964488296 Original CRISPR TTTGTTTTTTACTTTTGTCA GGG (reversed) Intergenic