ID: 964488297

View in Genome Browser
Species Human (GRCh38)
Location 3:157208527-157208549
Sequence GTTTGTTTTTTACTTTTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964488297_964488300 9 Left 964488297 3:157208527-157208549 CCTGACAAAAGTAAAAAACAAAC No data
Right 964488300 3:157208559-157208581 AGAGAGCCCCAAGAATGCCTTGG No data
964488297_964488305 29 Left 964488297 3:157208527-157208549 CCTGACAAAAGTAAAAAACAAAC No data
Right 964488305 3:157208579-157208601 TGGCTTTTGCTTTTGTGATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964488297 Original CRISPR GTTTGTTTTTTACTTTTGTC AGG (reversed) Intergenic