ID: 964488300

View in Genome Browser
Species Human (GRCh38)
Location 3:157208559-157208581
Sequence AGAGAGCCCCAAGAATGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964488296_964488300 10 Left 964488296 3:157208526-157208548 CCCTGACAAAAGTAAAAAACAAA No data
Right 964488300 3:157208559-157208581 AGAGAGCCCCAAGAATGCCTTGG No data
964488297_964488300 9 Left 964488297 3:157208527-157208549 CCTGACAAAAGTAAAAAACAAAC No data
Right 964488300 3:157208559-157208581 AGAGAGCCCCAAGAATGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964488300 Original CRISPR AGAGAGCCCCAAGAATGCCT TGG Intergenic
No off target data available for this crispr