ID: 964489451

View in Genome Browser
Species Human (GRCh38)
Location 3:157219736-157219758
Sequence GTGTGTGTATGAAATAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964489451_964489452 25 Left 964489451 3:157219736-157219758 CCTACTTTATTTCATACACACAC No data
Right 964489452 3:157219784-157219806 GTTTTGCTTTGTTTTGAGACAGG 0: 15
1: 388
2: 624
3: 1791
4: 21796
964489451_964489454 29 Left 964489451 3:157219736-157219758 CCTACTTTATTTCATACACACAC No data
Right 964489454 3:157219788-157219810 TGCTTTGTTTTGAGACAGGGAGG No data
964489451_964489455 30 Left 964489451 3:157219736-157219758 CCTACTTTATTTCATACACACAC No data
Right 964489455 3:157219789-157219811 GCTTTGTTTTGAGACAGGGAGGG No data
964489451_964489453 26 Left 964489451 3:157219736-157219758 CCTACTTTATTTCATACACACAC No data
Right 964489453 3:157219785-157219807 TTTTGCTTTGTTTTGAGACAGGG 0: 21
1: 552
2: 1329
3: 18679
4: 29103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964489451 Original CRISPR GTGTGTGTATGAAATAAAGT AGG (reversed) Intergenic
No off target data available for this crispr