ID: 964495356

View in Genome Browser
Species Human (GRCh38)
Location 3:157283543-157283565
Sequence GTGTTGATGGTGAAGTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 336}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964495352_964495356 -8 Left 964495352 3:157283528-157283550 CCTGTGAATTTCTGTGTGTTGAT 0: 1
1: 0
2: 1
3: 37
4: 339
Right 964495356 3:157283543-157283565 GTGTTGATGGTGAAGTTGGTGGG 0: 1
1: 0
2: 1
3: 26
4: 336
964495351_964495356 6 Left 964495351 3:157283514-157283536 CCAGATATTAAACTCCTGTGAAT 0: 1
1: 0
2: 0
3: 16
4: 186
Right 964495356 3:157283543-157283565 GTGTTGATGGTGAAGTTGGTGGG 0: 1
1: 0
2: 1
3: 26
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964495356 Original CRISPR GTGTTGATGGTGAAGTTGGT GGG Intronic
900507551 1:3037232-3037254 GTGGTGATGGAGAAGCTGGTTGG + Intergenic
900551882 1:3260692-3260714 TTGATGATGGTGATGGTGGTGGG + Intronic
900975170 1:6012150-6012172 GTGATGAAGGTGGAGGTGGTGGG + Intronic
902095565 1:13941750-13941772 GTGGTGGTGGTGATGGTGGTAGG - Intergenic
902542710 1:17166118-17166140 ATGTTGATGGTAAGGATGGTGGG - Intergenic
902738452 1:18417157-18417179 GTGTTGATGTTAATGCTGGTCGG + Intergenic
902758656 1:18566578-18566600 ATGTAGATGGTGAAGGTGGGTGG + Intergenic
903235956 1:21950991-21951013 GTGCTGGTGGTGGAGTTGTTTGG + Intergenic
903476951 1:23626145-23626167 GTGGTGATGGTGATGATGATGGG + Intronic
903671141 1:25036135-25036157 GTGTTGATGATGTGGATGGTGGG - Intergenic
905918463 1:41702200-41702222 GTAATGATGTTGATGTTGGTGGG - Intronic
907770051 1:57452587-57452609 GTGGTGCTGGTGATGGTGGTGGG + Intronic
908488526 1:64619149-64619171 ATGTAGATGGTGAAATTGGAAGG + Intronic
909153701 1:72042580-72042602 GAGTTGATGGGGAAGAGGGTAGG - Intronic
909468894 1:76004174-76004196 GTGTTGATGTAGATGATGGTGGG - Intergenic
910880302 1:91917204-91917226 GTGTTGATGTTAACGCTGGTTGG + Intergenic
911299821 1:96158206-96158228 GTGCTGGTGGAGAAGGTGGTTGG - Intergenic
911470234 1:98309180-98309202 GTGTAGATGGTGAAATGGTTTGG - Intergenic
913213306 1:116599595-116599617 GTGATGATGGTGCAGTGGGTGGG + Intronic
913223308 1:116676820-116676842 GTGGTGATGATGGAGGTGGTGGG + Intergenic
913281083 1:117185614-117185636 GTGTTGATTGTAATGCTGGTGGG - Intronic
914267147 1:146047976-146047998 GTGTTGATGTTAATGCTGGTTGG - Intergenic
915068298 1:153244447-153244469 GTGGTGGTGGTGGAGGTGGTGGG + Intergenic
915656061 1:157361367-157361389 GAGATGAGGGTGAAGGTGGTGGG + Intergenic
917805235 1:178607179-178607201 CTGTAGAAGGTGATGTTGGTTGG - Intergenic
918684764 1:187400720-187400742 GTGATGATGATGATGTTTGTTGG - Intergenic
923057582 1:230438775-230438797 GTTTTGTGAGTGAAGTTGGTGGG + Intergenic
924167516 1:241300204-241300226 GTGTTGATAGTGGGGTAGGTTGG - Intronic
924769519 1:247066727-247066749 GTGTTGATGTTAATGCTGGTTGG - Intronic
1063730639 10:8693357-8693379 ATGATGACGGTGATGTTGGTAGG - Intergenic
1063852499 10:10208886-10208908 GTCTTCATGGTGATGTTGGTGGG + Intergenic
1063858795 10:10285716-10285738 GTGTTTGTGGTGATGCTGGTGGG + Intergenic
1064309099 10:14196100-14196122 GTGTTTATGGTCAAGCTGGAAGG - Intronic
1066467567 10:35667183-35667205 GTGATGGTGGTGATGATGGTGGG - Intergenic
1066467649 10:35667566-35667588 GTGATGGTGGTGATGATGGTGGG - Intergenic
1067282138 10:44880742-44880764 CTGTTGATGGGGGAGATGGTGGG + Intergenic
1068632094 10:59308590-59308612 GTGGTGATGGTGATGCTGGTTGG - Intronic
1069333032 10:67316456-67316478 TTGTTGATGGTGGTGGTGGTGGG - Intronic
1071316431 10:84404294-84404316 TTGTTGATGGGGAAGCAGGTTGG + Intronic
1072169049 10:92842693-92842715 GTGGTGGTGGTGGAGTTGGTGGG + Intronic
1075329018 10:121559144-121559166 GTGTTGATGGTGACGTTTTTGGG - Intronic
1075568991 10:123525341-123525363 TTGATGATGGTAAAGATGGTGGG + Intergenic
1076005819 10:126947668-126947690 CTGTTGGTGGTGATGGTGGTTGG + Intronic
1076005910 10:126948172-126948194 CTGTTGGTGGTGATGGTGGTTGG + Intronic
1076259242 10:129052629-129052651 GTGAAGATGGTGAACTTGGTGGG - Intergenic
1076720850 10:132392218-132392240 GTGGTGATGGTGACAATGGTGGG + Intergenic
1077156236 11:1092996-1093018 GTGGTAGTGGTGAAGGTGGTGGG - Intergenic
1077417009 11:2428761-2428783 GTGATGATGATGATGGTGGTGGG + Intergenic
1077911139 11:6571918-6571940 GTGTTGGGGGTGAGCTTGGTGGG - Exonic
1078011879 11:7578701-7578723 GTTTTGATGGAGAAGGGGGTTGG + Intronic
1078467726 11:11562566-11562588 GGTTTGATGGTGATGGTGGTGGG - Intronic
1078500994 11:11876368-11876390 ATGATGATGGTGCTGTTGGTAGG - Intronic
1078822506 11:14895925-14895947 GTGATGATGATGATGGTGGTGGG + Intergenic
1080010484 11:27453951-27453973 GTGTTGATGCTAATGCTGGTTGG - Intronic
1080045269 11:27801408-27801430 GTGTTGATGTTAATGCTGGTTGG + Intergenic
1080686215 11:34517196-34517218 GGGATGGTGGTGAAGTTGGCAGG - Intergenic
1081479001 11:43466410-43466432 CTGTTGATGGTGATGTTGAAGGG - Intronic
1081597411 11:44468512-44468534 ATGTTGATGGGTAAGTTGGCAGG + Intergenic
1083015532 11:59449263-59449285 GTGATGATGGGGAAGTTGTCAGG + Intergenic
1083583583 11:63840142-63840164 GTGATGAGGGTGGAGCTGGTGGG - Intronic
1083660615 11:64250375-64250397 GAGTTGATGGAGAACTTGGCGGG + Intergenic
1084025455 11:66445658-66445680 GTGTTGATGTTAATGCTGGTTGG - Intronic
1084789094 11:71462207-71462229 GTGTTGATGCTCATGCTGGTCGG - Intronic
1087188829 11:95231220-95231242 GTGGAGGTGGTGAAGGTGGTGGG - Intronic
1087226082 11:95600725-95600747 GTTGTGTTGGTGAAGGTGGTGGG - Intergenic
1088619083 11:111663717-111663739 GTGGTCATGGTGCAGGTGGTAGG + Intronic
1089470255 11:118715024-118715046 GTGTTGATGTTGATGCTGGAGGG + Intergenic
1090185287 11:124735033-124735055 GTGTTGATGTTAATGCTGGTCGG - Intergenic
1093550314 12:20402073-20402095 GTGCTGCTGGGGAAGTTGTTAGG + Intronic
1093624800 12:21332461-21332483 GTGTTGATGTTAATGATGGTTGG + Intronic
1095866336 12:46976450-46976472 GTGGTGGTGGTGGAGGTGGTAGG + Intergenic
1097339149 12:58417578-58417600 TTGTTGATGGTGAAGTTGGAAGG + Intergenic
1099102646 12:78461056-78461078 GTGTTGATGTTAATGCTGGTTGG + Intergenic
1101740670 12:107497491-107497513 GTGGTGATGATGATGGTGGTGGG - Intronic
1104050552 12:125190968-125190990 GTGGTGATGGTGATGGTGATGGG + Intronic
1104050637 12:125191230-125191252 GTGGTGATGGTGATGGTGATGGG + Intronic
1104205810 12:126637409-126637431 GAGTTGATGGTGGAGATGGAAGG - Intergenic
1104743993 12:131199271-131199293 ATGATGATGGTGAGGATGGTGGG - Intergenic
1105676717 13:22679712-22679734 GTGGTGGTGGTGAAGGTGATGGG - Intergenic
1105728927 13:23192325-23192347 GAGTTTCTGTTGAAGTTGGTAGG + Intronic
1105775792 13:23658978-23659000 GTGTTTATGGCGAAGCTGGCAGG - Intronic
1106219863 13:27736764-27736786 CTGGTGAGGGTGAAGTTGGGAGG - Intergenic
1109426428 13:62170105-62170127 GTGCTGTTGGTGAAATTAGTTGG - Intergenic
1110463223 13:75770315-75770337 ATGTTGATGGGGATGTGGGTGGG + Intronic
1112422635 13:99266950-99266972 GTGTTGCTGGTGCAGCTGCTGGG - Intronic
1113611685 13:111650705-111650727 GCCATGATGGTGAAGTTGGGTGG + Intronic
1113717902 13:112526704-112526726 ATGTTGATGGTGATGATGATGGG - Intronic
1114080094 14:19196300-19196322 GTGTTGATGTTAATGCTGGTTGG - Intergenic
1115453115 14:33571550-33571572 CTTTTGATGGTAAAGTAGGTAGG + Intronic
1115516556 14:34191310-34191332 GTGTTCATGAGGAAATTGGTTGG - Intronic
1116210139 14:41928099-41928121 GTGCTGAAGGTGCAGCTGGTGGG + Intergenic
1118549808 14:66937876-66937898 ATGATGATGGTGAAGTTTCTTGG - Intronic
1118750877 14:68807269-68807291 GGGTGGAGGGTGCAGTTGGTGGG - Intergenic
1119501770 14:75134786-75134808 GCCTTGATGGTGCTGTTGGTAGG + Exonic
1120188334 14:81417311-81417333 GTGTGGATGGTGATGTGGGAGGG - Intronic
1120622993 14:86789076-86789098 GTGTTGATGTTAAACGTGGTCGG - Intergenic
1122346328 14:101063116-101063138 GTGTTTACAGTGGAGTTGGTGGG + Intergenic
1125277095 15:38004526-38004548 GTGGTGCTGGTGAAGCTTGTTGG + Intergenic
1125457355 15:39873732-39873754 GTGGTGATGGTGAAGGTGCAGGG - Intronic
1127639954 15:60907118-60907140 GTGATGATGATAATGTTGGTGGG - Intronic
1129412670 15:75358663-75358685 GTGGGGATGGTGGAGGTGGTGGG - Intronic
1130970458 15:88728126-88728148 GTGGTGATGGTGTATGTGGTAGG + Intergenic
1131481617 15:92787193-92787215 GAATTGATGATGAAGATGGTGGG - Intronic
1132128716 15:99253561-99253583 GAGTTGCTGGAGAAGTGGGTGGG + Intronic
1132437166 15:101817427-101817449 GTGGTGATTGTGATGATGGTGGG + Intronic
1134282095 16:12826090-12826112 GTGTTGATGTTAATGCTGGTTGG + Intergenic
1135256577 16:20946128-20946150 GTGTTGATGGTAATGCTGGAGGG - Intronic
1135638303 16:24097973-24097995 GTGTTGATGTTAATGCTGGTTGG + Intronic
1137227972 16:46533158-46533180 GCCTTGATGATGATGTTGGTTGG - Intergenic
1137798237 16:51239723-51239745 GTGGTGATGGTGGAGGTGGTGGG + Intergenic
1137798253 16:51239782-51239804 GTGGTGATGGTGGAGGTGGTGGG + Intergenic
1138084413 16:54120692-54120714 ATGTTGAAGGTGAACTTGGGAGG - Exonic
1140479276 16:75253722-75253744 GTGTTGATGGGGATGTAGCTGGG + Intronic
1140984740 16:80147407-80147429 ATGGTGATGGTGAAGGTTGTTGG - Intergenic
1141179774 16:81744560-81744582 GTCATGATGGTGAAGCTGGTGGG + Intronic
1141839545 16:86566005-86566027 GTTTCGAAGCTGAAGTTGGTAGG + Intergenic
1141878447 16:86842195-86842217 GTCTTGATGTTGTAGTTGGGGGG + Intergenic
1142064474 16:88053254-88053276 GTGATGATAGTGAAGGAGGTGGG - Intronic
1142064497 16:88053374-88053396 GTGATGATAGTGAAGGAGGTGGG - Intronic
1142064537 16:88053620-88053642 GTGATGATAGTGAAGGAGGTGGG - Intronic
1142064576 16:88053854-88053876 GTGATGATAGTGAAGGAGGTGGG - Intronic
1142064597 16:88053968-88053990 GTGATGATAGTGAAGGAGGTGGG - Intronic
1142064637 16:88054214-88054236 GTGATGATAGTGAAGGAGGTGGG - Intronic
1142087734 16:88193129-88193151 GTGATGGTGGTGATGGTGGTGGG + Intergenic
1142087752 16:88193186-88193208 GTGGTGGTGGTGATGGTGGTGGG + Intergenic
1143252887 17:5535920-5535942 GTGGTGGTGGTGAGGGTGGTGGG + Intronic
1144570767 17:16397199-16397221 GTGTTGATGTTAATGCTGGTTGG - Intergenic
1145012273 17:19376378-19376400 GTGTTGATGTTAATGTTGGAGGG - Intronic
1145362903 17:22226973-22226995 GTGTTGATGTTAATGCTGGTTGG - Intergenic
1145970977 17:28956374-28956396 GTGGCGATGGTGTTGTTGGTAGG - Exonic
1146708797 17:35022708-35022730 GTGTCGATGGAGCAGTGGGTGGG - Intronic
1147576000 17:41599325-41599347 ATGTTGGTGGTGATGGTGGTGGG + Intergenic
1148344796 17:46895931-46895953 GTCTTGAAGGGGAAGCTGGTGGG + Intergenic
1149456538 17:56792879-56792901 GTGGTGGTGGTGATGGTGGTGGG + Intronic
1150340557 17:64363283-64363305 TTCTGGATGGTGAAGTTGGCTGG + Exonic
1151976130 17:77484386-77484408 GTGGTGATGGTGACAGTGGTGGG + Intronic
1151976325 17:77485341-77485363 GTGTTGATGGTGATAGTGGTGGG + Intronic
1152599333 17:81253735-81253757 ATGATGATGGTGATGGTGGTAGG - Intronic
1152599342 17:81253786-81253808 ATGATGATGGTGATGGTGGTAGG - Intronic
1152599354 17:81253858-81253880 ATGATGATGGTGATGGTGGTAGG - Intronic
1152634418 17:81424733-81424755 GTGGTGATGGTGATGTAGTTGGG + Intronic
1154395892 18:13988355-13988377 GTTTTGATGGAGAAGGTGATGGG + Intergenic
1154406553 18:14097047-14097069 GGTTTGATGGAGAAGGTGGTTGG - Intronic
1159503092 18:69298837-69298859 ATGATGTTGGTGATGTTGGTGGG - Intergenic
1160257464 18:77259492-77259514 GTGGTGGTGGTGATGGTGGTGGG + Intronic
1160890321 19:1374291-1374313 GTGCTGATGGAGAAGTTACTTGG + Intronic
1161150573 19:2706172-2706194 TTGTTGATGATGATGTTGTTTGG + Intergenic
1164478526 19:28593643-28593665 GTGGTGATGGTGATAGTGGTGGG - Intergenic
1164528674 19:29030376-29030398 ATGGTGATGGTGATGATGGTGGG + Intergenic
1164790393 19:30972510-30972532 GTGCGGATGGGGAAGTTTGTAGG + Intergenic
1168361784 19:55746964-55746986 GTGATGATGGTGATGATGGGGGG + Intergenic
925121810 2:1424364-1424386 GTGTTGATGTTGATGCTGGAGGG + Intronic
925609978 2:5694153-5694175 GTGTTGATGGTGGCGGTGGTAGG + Exonic
926020825 2:9494376-9494398 GACTTTATGGTAAAGTTGGTTGG - Intronic
926132395 2:10312169-10312191 ATGGTGATGGTGATGATGGTGGG - Intronic
926132411 2:10312355-10312377 GTGGTGATGGTGATGATGATGGG - Intronic
926132447 2:10312703-10312725 GTGGTGATGGTGATGATGATGGG - Intronic
927863728 2:26576038-26576060 GGGTTGGTGGAGAAGATGGTGGG - Exonic
929433003 2:41904419-41904441 GTGTAGATGATCAGGTTGGTTGG + Intergenic
930565830 2:53019561-53019583 GTGGTGATGGTGATGGTGGTGGG + Intergenic
931098437 2:58968501-58968523 GTGGTGGTGGTGATGATGGTAGG + Intergenic
933176523 2:79179867-79179889 ATGTTGATGATTAAGCTGGTGGG - Intergenic
934107721 2:88711030-88711052 CTGTTGATGGTGAAGCTCTTTGG + Intronic
934297778 2:91756527-91756549 GTGATAATGGTGCAGTGGGTGGG - Intergenic
934939296 2:98488981-98489003 GTGTAAATGGTGTAGTTTGTTGG + Intronic
935176813 2:100655945-100655967 GTGTTGAGGGAGTGGTTGGTAGG + Intergenic
935427216 2:102932655-102932677 GTGTTGATAGCGAATGTGGTTGG + Intergenic
936030421 2:109066477-109066499 GTGGTGAGGGACAAGTTGGTGGG - Intergenic
936619285 2:114078364-114078386 ATGATGATGGTGAAGGTGATAGG - Intergenic
937117646 2:119420105-119420127 GTGTTGAAGGTGGGGCTGGTGGG - Intergenic
937353542 2:121184170-121184192 GTGATGGTGGTGGGGTTGGTGGG - Intergenic
937496713 2:122428206-122428228 GTGTGGAAGGTGGAGTTGCTGGG - Intergenic
937651817 2:124327504-124327526 GTGTTGATGTTAATGCTGGTTGG - Intronic
938009919 2:127820746-127820768 GGGCTGATGGTGCAGTTGGAGGG - Intergenic
938115270 2:128598334-128598356 GTGATGATGGTGATGATGATGGG - Intergenic
940742199 2:157521396-157521418 GTGTTGATGGTTTACTTGGGAGG - Intergenic
941864772 2:170323406-170323428 GAGTTGATGCTTAAGTTGATAGG + Intronic
943566908 2:189526780-189526802 GTGTTGATGGAGAAGGAGGAGGG - Intergenic
945446817 2:209948694-209948716 GTGATGATGGTGATGATGGTGGG + Intronic
947339234 2:229120008-229120030 GAGTTGGTGGTGTAGTTTGTAGG - Intronic
947382934 2:229562980-229563002 ATGTTGATGATGATGTTGATGGG - Intronic
947383108 2:229564028-229564050 GTGTTGATGATGATGGTGATGGG - Intronic
947404416 2:229759930-229759952 GTGGTGATGGTGATGTTAGGAGG + Intergenic
947619377 2:231579584-231579606 GTGGTGATGGTGGTGATGGTAGG - Intergenic
948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG + Intronic
1169815157 20:9648842-9648864 GTGTGGATGGTGAGGTTTCTTGG + Intronic
1170956318 20:20983187-20983209 GTGCTGATGGTTAATTTGGGAGG + Intergenic
1172327433 20:34047377-34047399 GTGTTGATGGTGACTCTGCTTGG + Intronic
1172460653 20:35115821-35115843 TTGTTGTGGATGAAGTTGGTTGG + Exonic
1172482822 20:35281017-35281039 TTGGTGATGGTGAAGTAGGCAGG - Intronic
1173988691 20:47283038-47283060 GTGTTGGGGGTGGGGTTGGTGGG - Intronic
1174677923 20:52376164-52376186 GTGCTGGGGGTGAAGTGGGTTGG - Intergenic
1175029510 20:55938356-55938378 GTGTTGATGATGAGGGAGGTAGG - Intergenic
1175933494 20:62504432-62504454 ATGGTGATGGTGATGATGGTGGG - Intergenic
1175976405 20:62712557-62712579 GAGTTGATGGTGGAGTGGGCAGG + Intronic
1176151276 20:63592373-63592395 GTGCTGAGGCTGAACTTGGTGGG - Intronic
1176677743 21:9795605-9795627 TTGATGATGGTGGAGTTGGGTGG - Intergenic
1177957075 21:27611614-27611636 GTGGTGATGGTGGTGTTGGCGGG - Intergenic
1179710949 21:43262650-43262672 GTGGTGATGGTGGTGGTGGTGGG + Intergenic
1180500680 22:15926400-15926422 GTGTTGATGTTAATGCTGGTTGG + Intergenic
1181832628 22:25573943-25573965 GTGTTGTTGGTGTTGTTGTTTGG - Intronic
1183770140 22:39917354-39917376 GTGTTGTTAGTGAAATTGGCTGG - Intronic
949461780 3:4302521-4302543 GTGTTGATGTTGATGCTGGCTGG + Intronic
950573518 3:13816816-13816838 GTGTGGATGGATAAGTAGGTGGG - Exonic
950853349 3:16083330-16083352 GTTTTGGTGGTGATGATGGTTGG + Intergenic
952139918 3:30466744-30466766 CTGTTGATGGTCAGGTTTGTGGG + Intergenic
952270034 3:31821409-31821431 TTGTTGATAGTGAAGCAGGTTGG - Intronic
953043573 3:39276108-39276130 GTGAAGATGGTGGAGTTGGGAGG + Intronic
954380736 3:50217712-50217734 GTGGTGTTGTTGAAGTTGGGGGG - Exonic
955339230 3:58112166-58112188 GTGTAGACAGTGAAGTGGGTCGG - Exonic
956547611 3:70422264-70422286 GAGGTGAAGGTGAAGTTGGTGGG - Intergenic
957436502 3:80183776-80183798 GTATTGATTGTGAAACTGGTTGG + Intergenic
957708188 3:83817335-83817357 TTGTTGATAGTGCAGTTGGTAGG - Intergenic
958525896 3:95258663-95258685 GTGTTGAAGGATAATTTGGTGGG - Intergenic
959384150 3:105680879-105680901 GTGTATATGTTGAAGTTGGCTGG - Intronic
961656497 3:128445340-128445362 GTGGTGATGGTGATAATGGTGGG + Intergenic
962284578 3:134075436-134075458 GTGGTGATGGGGAAGGTTGTGGG - Intronic
963627168 3:147688482-147688504 ATGATGATGGAGAAGTGGGTAGG - Intergenic
964108600 3:153065722-153065744 GTGTTGATGGAGAAGATACTAGG - Intergenic
964495356 3:157283543-157283565 GTGTTGATGGTGAAGTTGGTGGG + Intronic
968028132 3:195460253-195460275 ATGTTCATGTTGAAGGTGGTAGG - Intergenic
968067014 3:195764321-195764343 GTGTTGGTGGAGAGCTTGGTAGG + Intronic
968349219 3:198038851-198038873 GGGTTGCTGATGAAGGTGGTTGG - Exonic
968349223 3:198038872-198038894 GGGTTGCTGATGAAGGTGGTTGG - Exonic
968390945 4:192572-192594 GTGCTGTTGGTGAGGTTGGCTGG + Intergenic
968592911 4:1468280-1468302 GTGATGATTGTGATGATGGTAGG + Intergenic
969234602 4:5856857-5856879 GTGGTGATGGTGATGATGGTGGG - Intronic
969336294 4:6512218-6512240 GTGTTGGTGGTGGTGATGGTGGG + Intronic
969940624 4:10727432-10727454 GTGTTAATGGTGGAATTGGAGGG + Intergenic
970926628 4:21459837-21459859 ATGGTGATGGTGAAAGTGGTTGG - Intronic
971471418 4:27030977-27030999 GTAGTGATGGTGGAGATGGTGGG + Intergenic
972303230 4:37806007-37806029 GTGTTGATGTTAAAGCTGGAGGG - Intergenic
973584212 4:52374989-52375011 GTGTAGATGGTAAAGTTCATTGG + Intergenic
974496336 4:62633378-62633400 TTGTTGTTGGTGTTGTTGGTAGG - Intergenic
975936066 4:79582418-79582440 GTTTAGATGTAGAAGTTGGTGGG - Intergenic
976112068 4:81686240-81686262 GTGTTGATGTTAATGCTGGTTGG + Intronic
977310560 4:95381911-95381933 GTGTGTATGGGGCAGTTGGTGGG + Intronic
978127617 4:105152940-105152962 TTGGTGATGGTGATGATGGTAGG + Intronic
978427404 4:108596684-108596706 GTTTTTATGGTCAATTTGGTGGG - Intergenic
978643580 4:110901109-110901131 GTGATGATGGTGGTGGTGGTGGG + Intergenic
979439232 4:120731626-120731648 GTGGTCATGTGGAAGTTGGTGGG + Intronic
981997866 4:150994187-150994209 GTGGTGGTGGTGATGGTGGTGGG - Intronic
982334937 4:154224624-154224646 GTGTTGATGTGAATGTTGGTTGG - Intergenic
982693018 4:158569495-158569517 GTGTTGATGGTGGAGGAGGCAGG + Intronic
982767715 4:159367413-159367435 GTGGTGATGGTGAGGGCGGTGGG - Intergenic
983846014 4:172519401-172519423 ATATTGATGGTGAAGAGGGTTGG - Intronic
983847596 4:172539202-172539224 TAGATGATGGTGAAGTTGATGGG - Intronic
985397790 4:189563188-189563210 TTGATGATGGTGGAGTTGGGTGG + Intergenic
986400062 5:7371607-7371629 GTGGTGATGGTGGAGGTCGTTGG - Intergenic
986400288 5:7372620-7372642 GTGGTGATGGTGGAGGTGGTAGG - Intergenic
986502683 5:8416601-8416623 GTGTTGATGGTGAAGCTTCCAGG - Intergenic
987965925 5:24872563-24872585 GTGTTGAGAGAGAAGGTGGTTGG - Intergenic
990474382 5:56147548-56147570 GTGGTGACGGTGAACTGGGTGGG - Intronic
990495758 5:56346299-56346321 GTTTTTATGGTCAATTTGGTGGG + Intergenic
990789886 5:59465293-59465315 GTGTAGGTGGTGATGGTGGTAGG - Intronic
993663793 5:90670417-90670439 GTGCTTATGGTGTAGTTGATCGG + Intronic
994768985 5:103957164-103957186 GGGTTGATGCTGAAGTAGGATGG - Intergenic
995285691 5:110385761-110385783 GTGTTGATGTTAATGCTGGTTGG - Intronic
995358156 5:111263299-111263321 TTGTTAATGGTAAAGTTGGATGG + Intronic
995421470 5:111972278-111972300 CTGTTGATGTTGAATGTGGTTGG + Intronic
996244663 5:121247092-121247114 TGGTTGATGGTGCAGTTAGTAGG + Intergenic
997756778 5:136406998-136407020 GTGTTGATGTTCGAGTTGGAGGG + Intergenic
998076057 5:139237319-139237341 GTTTTGATGGACAATTTGGTGGG - Intronic
998655285 5:144171571-144171593 GTGGTGATGGTGGTGGTGGTTGG - Intronic
999062475 5:148651317-148651339 GTGAGGATGGTAAAGTTGGAAGG + Intronic
1001007083 5:168062093-168062115 GTGGTGAAGCAGAAGTTGGTCGG + Exonic
1002106604 5:176882336-176882358 GCACTGATGGTGATGTTGGTGGG - Intronic
1003001923 6:2344152-2344174 GTGGTGATGGTGTATTAGGTTGG - Intergenic
1004145284 6:13060276-13060298 GTGTAGAGTGAGAAGTTGGTAGG + Intronic
1004592899 6:17070621-17070643 GGGTTAATGCTGAAATTGGTTGG + Intergenic
1004821523 6:19373061-19373083 GTGTTGGTGGTGTCATTGGTGGG + Intergenic
1005219910 6:23574597-23574619 TTGTTGATACTGAAGTTGGGAGG + Intergenic
1005565441 6:27088278-27088300 GTGATGATGGTCATGGTGGTGGG - Intergenic
1005801075 6:29425685-29425707 ATGTTGATGTTGAAGCTGGATGG + Exonic
1007019335 6:38503653-38503675 GGGATGAGTGTGAAGTTGGTAGG - Intronic
1007369719 6:41418365-41418387 GTGATGGTGGTGAGGATGGTAGG - Intergenic
1007512762 6:42386966-42386988 GTGATGGTGGTGATGATGGTAGG - Intronic
1007960228 6:45952123-45952145 GTGGTGATGGTGGTGGTGGTGGG + Intronic
1010754663 6:79653633-79653655 GTTTTCATAGTGAAGTTAGTGGG + Intronic
1013635229 6:112022840-112022862 GCATTGATGGTGATGATGGTTGG - Intergenic
1014219731 6:118787902-118787924 ATGTTAATGGTGATGTTGGCTGG + Intergenic
1014471996 6:121827550-121827572 GGGTAGATGGTGATGTTAGTAGG + Intergenic
1014573072 6:123035448-123035470 GTGTTGAAGATGAAGATGTTGGG + Intronic
1015329556 6:131961649-131961671 GTGTTGGAGGTGGAGCTGGTGGG + Intergenic
1015455863 6:133425439-133425461 GTGCTGATGGCGAGGTTGGGGGG - Intronic
1015946257 6:138504413-138504435 GAGATGATGGTGAAGTTCCTAGG + Intronic
1016110505 6:140218316-140218338 GTTTTGGTGGTGATGGTGGTGGG + Intergenic
1016815006 6:148295242-148295264 GTCTTGATGCTGCAGTTGGGTGG + Intronic
1017042761 6:150320885-150320907 CTGTTAATTCTGAAGTTGGTTGG - Intergenic
1017150456 6:151274410-151274432 GTGGTGATGGTGGAGGAGGTGGG + Intronic
1017672117 6:156778219-156778241 GTGGTGGTGGTGGAGGTGGTGGG - Exonic
1017947923 6:159110918-159110940 GGGCTGATGGTGGAGATGGTTGG + Intergenic
1018132872 6:160749308-160749330 GTGGTGGTGATGATGTTGGTGGG - Intronic
1018962259 6:168457347-168457369 GTGTTGAAGGTGGGGTTGGATGG - Intronic
1019929079 7:4211466-4211488 GTATTGAAGGTGGAGCTGGTGGG + Intronic
1021099405 7:16571338-16571360 GTGTTGATGTTAATGCTGGTTGG - Intronic
1022180986 7:27919885-27919907 TTGTTGATTGTAAAGTTGTTTGG - Intronic
1024799975 7:53065431-53065453 ATGTTAATGGTGAAGTTAATTGG + Intergenic
1027809828 7:82881309-82881331 GTCTTGAAGGTGAAGTAGTTGGG + Intronic
1028390170 7:90306633-90306655 GTGATGATGGTGATGATGGCAGG + Intronic
1028685013 7:93582320-93582342 GTATTGGTGGTGGAGATGGTTGG + Intergenic
1028939035 7:96499911-96499933 GTGTTGATGGTGATATTTGATGG - Intronic
1029196918 7:98811548-98811570 GTGGTGATGGTGGTGATGGTTGG + Intergenic
1029925681 7:104313933-104313955 TTGTAGATGATGAAGTGGGTGGG + Intergenic
1030157030 7:106465729-106465751 GTGAGGATGTTGAAGTTGATGGG - Intergenic
1031932603 7:127701315-127701337 CTGTTAATGGTGAGGCTGGTGGG + Exonic
1032956031 7:136973099-136973121 GTGATGATGGTGACGGTGTTAGG + Intronic
1032956038 7:136973133-136973155 GTGATGATGGTGACGGTGTTAGG + Intronic
1032956045 7:136973167-136973189 GTGATGATGGTGACGGTGTTAGG + Intronic
1032956057 7:136973222-136973244 GTGATGATGGTGACGGTGTTAGG + Intronic
1032956064 7:136973256-136973278 GTGATGATGGTGACGGTGTTAGG + Intronic
1032956071 7:136973290-136973312 GTGATGATGGTGACGGTGTTAGG + Intronic
1032956148 7:136973661-136973683 GTGATGATGGTGATGGTGTTAGG + Intronic
1033031374 7:137830490-137830512 GTGCTAATGGTGACCTTGGTTGG + Intronic
1033313664 7:140280673-140280695 GGGTTGCAGGTGAAGATGGTGGG - Intergenic
1033496687 7:141905279-141905301 GTGATGATGGTGTAGTGGATAGG + Intergenic
1033513515 7:142083839-142083861 GTGGTGATGGTGACGATGATGGG + Intronic
1034869736 7:154673513-154673535 GTGTTGTTAGTGGAGTGGGTGGG + Intronic
1036177271 8:6550609-6550631 GCGTTGGTGGTGAAGTCTGTCGG + Intronic
1037128607 8:15380937-15380959 GTGTTGATTGGGTGGTTGGTTGG + Intergenic
1037143267 8:15542362-15542384 GTGTTGATGTTAATGCTGGTTGG + Intronic
1038693308 8:29782711-29782733 GGATTGGTGGTGAAGTAGGTTGG - Intergenic
1041073273 8:54145845-54145867 CTGTTGTAGGTGAAGTAGGTAGG + Intronic
1045440224 8:102201712-102201734 TTGTTGCTGGGGAAGTGGGTGGG - Intergenic
1045467276 8:102481926-102481948 GTGGTGATGATGACGGTGGTTGG - Intergenic
1047432752 8:124806926-124806948 GTTTTGATAGTGAAGTTTGAGGG + Intergenic
1048595590 8:135862543-135862565 GAGGTGATGGTGATGTTGGTGGG - Intergenic
1048792374 8:138115617-138115639 GTCTTGATGGGGAAGTAGGAGGG - Intergenic
1049274664 8:141713940-141713962 GTGGTGATGGTGACAGTGGTGGG + Intergenic
1049351695 8:142168021-142168043 GTGCTGATGATGAGGATGGTAGG - Intergenic
1049417516 8:142502035-142502057 GTGGTGGTGGTGATGGTGGTCGG + Intronic
1049925080 9:400472-400494 GTGGTGATGGTGAAGGAGGTGGG - Intronic
1052212873 9:25928310-25928332 GGGTTGATGGGGCAGTTGATGGG - Intergenic
1053442658 9:38128827-38128849 GTGGTGATGGTGGAGGTGGAGGG + Intergenic
1054767603 9:69055214-69055236 CTGTGGATGCTCAAGTTGGTAGG - Intronic
1055396393 9:75879560-75879582 GTGGTGGTGGTGGAGATGGTGGG + Intergenic
1055512954 9:77013346-77013368 GTGGTGGTGGTGGAGTTGGGGGG - Intergenic
1056135929 9:83629408-83629430 GTCTTGATCCTGAGGTTGGTGGG - Intronic
1056250073 9:84738955-84738977 GTTTTGCTGGTGAACTTGGTAGG + Intronic
1056775272 9:89507772-89507794 GTGTTGATGTTGATGCTGGAGGG + Intergenic
1059436242 9:114278260-114278282 GTGATGATGATGAAGATGATGGG + Intronic
1060227630 9:121804086-121804108 GTGTTGAGGGTGAGGGTGGACGG - Intergenic
1060227804 9:121806080-121806102 GTGTTGAGGGTGAGGGTGGACGG + Intergenic
1060509304 9:124220610-124220632 CTGTTGATGGTGAAATGGGAAGG - Intergenic
1185672756 X:1825445-1825467 GTGCTGGTGGTGAAGCTGGATGG - Intergenic
1185672820 X:1825735-1825757 GTGTTGGTGGTGAGGCTGGATGG - Intergenic
1185672994 X:1826544-1826566 GTGTTGGTGGTGAAGCTGGATGG - Intergenic
1185673021 X:1826660-1826682 GTGTTGGTGGTGAGGCTGGATGG - Intergenic
1185910575 X:3977057-3977079 GTGTTGATGTTAAAGCTGGAGGG + Intergenic
1186527131 X:10258939-10258961 GGGTTGATGGAGAAGTTGCCAGG + Intergenic
1188208609 X:27391911-27391933 GGGTAGATAGTGAAGTTGCTGGG - Intergenic
1188529382 X:31122421-31122443 GTGATAATGGTGACGATGGTTGG - Intronic
1189238005 X:39503378-39503400 GTGTAGATGCTGAAGTTGTAAGG + Intergenic
1190301064 X:49057863-49057885 GTGGTGATGGTGGTGGTGGTGGG + Intronic
1192225481 X:69224391-69224413 GTGTTGATTGAGGAGTTCGTGGG - Intergenic
1193652458 X:84154645-84154667 GTGGTGGTGATGAAGTTGGTGGG - Intronic
1194294046 X:92106906-92106928 GTGTTGATGCTAATGCTGGTGGG - Intronic
1197465153 X:126795889-126795911 GTGTTGGTGGTGAGGGTGGGAGG + Intergenic
1198820766 X:140645810-140645832 GTGATGATTTTAAAGTTGGTGGG - Intergenic
1200101481 X:153690899-153690921 GTGTTGATGGTGGTGGTGGGGGG - Intronic
1200212706 X:154353932-154353954 GTGTTGACGGTGAAGGTGGCAGG + Exonic
1200214272 X:154360520-154360542 GTGTCGATGGTGAAGCGGGCGGG + Exonic
1200611557 Y:5331425-5331447 GTGTTGATGCTAATGCTGGTGGG - Intronic
1202067142 Y:20951781-20951803 GTGTTGATGGAGTTGTTGGTGGG + Intergenic