ID: 964496240

View in Genome Browser
Species Human (GRCh38)
Location 3:157293344-157293366
Sequence GAGGTACACATGACTATATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964496234_964496240 21 Left 964496234 3:157293300-157293322 CCCATTGGCTCTCATATTTCTAT 0: 1
1: 0
2: 0
3: 17
4: 253
Right 964496240 3:157293344-157293366 GAGGTACACATGACTATATGAGG 0: 1
1: 0
2: 3
3: 15
4: 211
964496235_964496240 20 Left 964496235 3:157293301-157293323 CCATTGGCTCTCATATTTCTATG 0: 1
1: 0
2: 0
3: 23
4: 282
Right 964496240 3:157293344-157293366 GAGGTACACATGACTATATGAGG 0: 1
1: 0
2: 3
3: 15
4: 211
964496238_964496240 -3 Left 964496238 3:157293324-157293346 CCTAATTAGTAAGGGAACTCGAG 0: 1
1: 0
2: 0
3: 4
4: 45
Right 964496240 3:157293344-157293366 GAGGTACACATGACTATATGAGG 0: 1
1: 0
2: 3
3: 15
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964496240 Original CRISPR GAGGTACACATGACTATATG AGG Intronic
900734753 1:4291563-4291585 GAGGTACACATGCATAGGTGGGG + Intergenic
906643365 1:47455278-47455300 GAGGTTCACATGAGTGTGTGTGG + Intergenic
906753706 1:48289113-48289135 GAGGGACACCTGGCCATATGAGG - Intergenic
907845241 1:58199702-58199724 GAGAAACACATGACTTTAAGAGG - Intronic
910281791 1:85509082-85509104 GAGGGGCACCTGCCTATATGAGG - Intronic
911922086 1:103777205-103777227 GAGGTACATAGGCCAATATGGGG + Intergenic
913363065 1:118004196-118004218 GAGGGGCACCTGCCTATATGAGG + Intronic
915880543 1:159666689-159666711 GAGGGACAAATGACTAGCTGAGG + Intergenic
916756786 1:167778379-167778401 CAGGTACACACCACTATATCTGG - Intronic
917440730 1:175066795-175066817 GAGGTTCAAATGAGTAGATGGGG - Intergenic
917464280 1:175261620-175261642 GAGGGACACCTGCCTGTATGAGG + Intergenic
917579126 1:176356599-176356621 GAGGGACACCTGCCTGTATGAGG - Intergenic
919195868 1:194285221-194285243 TATGTACACATGCATATATGTGG - Intergenic
922433313 1:225577852-225577874 TAAGCACACATGACTACATGTGG - Intronic
1063144384 10:3283590-3283612 CAGGTACACATCACCATATCTGG + Intergenic
1065473016 10:26102773-26102795 GAGGGGCACCTGGCTATATGAGG + Intronic
1066755121 10:38703726-38703748 GAGGGACACTTGGCTGTATGAGG - Intergenic
1068239699 10:54289126-54289148 GAGGGGCACCTGCCTATATGAGG - Intronic
1070637534 10:78141247-78141269 TAGGTATGCATGAATATATGTGG + Intergenic
1072775005 10:98182418-98182440 GAGGGGCACCTGGCTATATGAGG + Intronic
1073628784 10:105126911-105126933 GATGTACAAATGACAATATAAGG - Intronic
1073745940 10:106467989-106468011 GAGGGACACCTGCCTGTATGAGG - Intergenic
1075920890 10:126211732-126211754 GAGGCAGAGATGACTATTTGCGG - Intronic
1076988125 11:253935-253957 GATGTACACATGAGTGTCTGAGG - Intergenic
1078716217 11:13841239-13841261 GAGGTACCAACAACTATATGTGG - Intergenic
1079772350 11:24477667-24477689 GAGGTTTACATAATTATATGAGG + Intergenic
1080188154 11:29516832-29516854 TAGGTACACAGGAATATAGGTGG - Intergenic
1080489419 11:32747316-32747338 GAGGGGCACCTGCCTATATGAGG + Intronic
1082192752 11:49267077-49267099 GTGGTACACATGCCCATCTGAGG - Intergenic
1083531637 11:63428543-63428565 GAGGGACACCTGCCTGTATGAGG - Intergenic
1084237066 11:67795047-67795069 TAGGTACTCATAACTATGTGTGG + Intergenic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1085800773 11:79586826-79586848 GAGGGACACCTGCCTGTATGAGG - Intergenic
1086673369 11:89573913-89573935 GTGGTACACATGCCCATCTGAGG + Intergenic
1086779536 11:90885208-90885230 GTGTGACAAATGACTATATGAGG + Intergenic
1086872420 11:92054669-92054691 CAGGTGCAGATGAGTATATGTGG - Intergenic
1087653976 11:100901293-100901315 GAGGGGCACATGCCTATATGAGG + Intronic
1089668774 11:120037604-120037626 GAGGTAAACAAGGCTAAATGAGG + Intergenic
1091185136 11:133640231-133640253 GAGGGCCACATGACCATCTGAGG + Intergenic
1091922363 12:4315648-4315670 GAGGTACACATGAATTGTTGGGG - Intergenic
1092560824 12:9611074-9611096 GAGGGACACCTGGCTGTATGAGG - Intergenic
1092562617 12:9632646-9632668 GAGGGACACCTGGCTGTATGAGG + Intergenic
1093802375 12:23389434-23389456 GAGGGGCACCTGGCTATATGAGG - Intergenic
1093932646 12:24969694-24969716 TAAGAACACATGAATATATGAGG + Intergenic
1093992832 12:25609724-25609746 GAGGGGCACCTGGCTATATGAGG + Intronic
1095455896 12:42385368-42385390 CAGGGACATATGAATATATGTGG + Intronic
1095706389 12:45241951-45241973 GAGGGACACCTGCCTGTATGAGG + Intronic
1096057118 12:48663224-48663246 GAGGTAAAAATTACCATATGAGG + Intronic
1097365667 12:58709754-58709776 CAGGGACACCTGGCTATATGGGG + Intronic
1100104106 12:91147582-91147604 CAGGTCTACATGACTATATTGGG + Intronic
1101981005 12:109406858-109406880 GAGGTAAAAATGGCTATAGGTGG + Exonic
1106923929 13:34593011-34593033 GAGGTAAACATGAACAGATGAGG + Intergenic
1107135439 13:36939058-36939080 GGGGTACCCATGATGATATGGGG + Intergenic
1107227896 13:38072888-38072910 AAGGGACACATGACACTATGGGG - Intergenic
1108270004 13:48750215-48750237 GAGAGACACACGACTAGATGAGG - Intergenic
1108679954 13:52771509-52771531 GATGAACATATGACTACATGTGG + Intergenic
1109739694 13:66536511-66536533 GAGGAAAACATGACTCAATGTGG + Intronic
1111534712 13:89588062-89588084 GAGGTACACTTCAGTAAATGGGG - Intergenic
1112389190 13:98967299-98967321 GAACTACACATAACTATGTGTGG - Intronic
1118553764 14:66989018-66989040 GAGATACACATGACTATGTGTGG - Intronic
1118559828 14:67067334-67067356 GAGGGACACCTGCCTGTATGAGG + Intronic
1120819033 14:88894930-88894952 CAGGTAAACATGAATATTTGGGG + Intergenic
1125277074 15:38004389-38004411 GGGGCACACATGACCAGATGGGG - Intergenic
1125837430 15:42764870-42764892 GAGGGGCACCTGGCTATATGAGG - Intronic
1126121352 15:45254645-45254667 AAGTAACACATGACTATATATGG + Intronic
1128391976 15:67188461-67188483 CAGGTAGACCTGACTATATCAGG - Intronic
1132064258 15:98717588-98717610 GAGGTACATATGTCTATATCGGG + Intronic
1134246917 16:12547067-12547089 GAGGCAGACATGCCTATGTGAGG + Intronic
1136727559 16:32373118-32373140 GAGGGACACCTGGCTGTATGAGG + Intergenic
1202998874 16_KI270728v1_random:144632-144654 GAGGGACACCTGGCTGTATGAGG - Intergenic
1203130472 16_KI270728v1_random:1681040-1681062 GAGGGACACCTGGCTGTATGAGG - Intergenic
1151172676 17:72260745-72260767 GAGGTTCACATGACTCAAAGGGG - Intergenic
1153582919 18:6593652-6593674 GAGGTACACATGACTGGGGGAGG - Intergenic
1154153751 18:11927913-11927935 GAGTTGGACATGACTATCTGAGG + Intergenic
1156291271 18:35750493-35750515 GTTGTACACATGCCTATCTGAGG + Intergenic
1157561527 18:48649715-48649737 GAGGTGCACCTGCCTGTATGAGG - Intronic
1158423793 18:57320779-57320801 AAGTGACACATGACTATATTTGG - Intergenic
1158424220 18:57324516-57324538 GAGGTACATTTGACAATATCTGG + Intergenic
1164235206 19:23325758-23325780 GAGGTACTTATGACTCAATGAGG - Intronic
925227614 2:2199425-2199447 CAGATACCCATGACTATCTGCGG + Intronic
927848978 2:26487089-26487111 GTGGTACAAATGACAAAATGTGG + Intronic
932690797 2:73911779-73911801 TATGTGGACATGACTATATGTGG + Intronic
934165655 2:89291864-89291886 GTTGTACACATGCCTATCTGAGG - Intergenic
934201622 2:89890592-89890614 GTTGTACACATGCCTATCTGAGG + Intergenic
934318413 2:91947959-91947981 GAGGGACACCTGGCTGTATGAGG - Intergenic
934531661 2:95093470-95093492 GAGGGACACCTGGCTGTATGAGG - Intronic
936279247 2:111123061-111123083 GAGGTGCACATCTCTAAATGGGG - Intronic
939300311 2:140329157-140329179 GAGGTACCCATGAGTATGTAGGG - Intronic
939408638 2:141794882-141794904 CAGGTACACACAACTATATTGGG + Intronic
939726988 2:145733036-145733058 GAGGTATTCATGAGTAGATGAGG + Intergenic
942958654 2:181803949-181803971 GAGGGGCACCTGCCTATATGAGG + Intergenic
944331235 2:198468859-198468881 GAGTTAAATATTACTATATGTGG + Intronic
944930336 2:204511068-204511090 CAGGTACTCATGACAATATTTGG + Intergenic
945716047 2:213359157-213359179 GAGGGGCACCTGCCTATATGAGG + Intronic
946294414 2:218772639-218772661 GAGGGACAGCTGCCTATATGAGG + Intergenic
946674464 2:222144124-222144146 CAGGTACACATCACCATACGCGG + Intergenic
1169619230 20:7486538-7486560 GAGGTACACCTGACTCTAAGAGG - Intergenic
1174946032 20:54986532-54986554 GAGGTACACGAGCTTATATGAGG - Intergenic
1177596326 21:23247970-23247992 GGGGTACACATGCCCATCTGAGG + Intergenic
1179768569 21:43595117-43595139 CAGGTACACATCACCACATGTGG - Intronic
1180306597 22:11131641-11131663 GAGGGACACCTGGCTGTATGAGG - Intergenic
1180545115 22:16493824-16493846 GAGGGACACCTGGCTGTATGAGG - Intergenic
1181442559 22:22944312-22944334 GAGGGACACACGTCTATATTTGG + Intergenic
1182803511 22:33051478-33051500 GAGGCACACATGCCTACATTGGG + Intronic
1183135053 22:35879145-35879167 GAGGAAGACATGAGTATATCTGG + Intronic
1183274687 22:36886329-36886351 GAGGTAGACAGGACTATGTGTGG - Intergenic
949548070 3:5089668-5089690 GAGGTACATTTGAAAATATGTGG - Intergenic
951617798 3:24567468-24567490 GAGGGACACCTGGCTATATGAGG - Intergenic
951833723 3:26959075-26959097 GAGGTGCACCTGCCTGTATGAGG + Intergenic
954295420 3:49671973-49671995 GAGGTACTCCTGACCATCTGAGG - Intergenic
956993354 3:74794832-74794854 GAGGGGCACCTGACTGTATGAGG - Intergenic
958137929 3:89520410-89520432 GAGGGAGACGTAACTATATGAGG + Intergenic
958423096 3:93950451-93950473 GAGGGACACCTGGCTGTATGAGG - Intronic
959569288 3:107866191-107866213 GAGGTAAACAAGCCTGTATGAGG + Intergenic
960217569 3:115060664-115060686 AAATTAAACATGACTATATGGGG + Intronic
963438823 3:145310441-145310463 AAATTACACATGTCTATATGGGG - Intergenic
964496240 3:157293344-157293366 GAGGTACACATGACTATATGAGG + Intronic
965048983 3:163619437-163619459 GAGATAGACATGACCACATGAGG - Intergenic
965760094 3:172066323-172066345 AAGGTACACAAGATCATATGTGG - Intronic
966861979 3:184235640-184235662 GAGGTACACATGGCTGTGTGTGG - Intronic
966861984 3:184235670-184235692 GAGGTACACATGGCTGTGTGTGG - Intronic
966861989 3:184235700-184235722 GAGGTACACATGGCTGTGTGTGG - Intronic
966861994 3:184235730-184235752 GAGGTACACATGGCTGTGTGTGG - Intronic
966862004 3:184235790-184235812 GAAGTACACATGACTGTGTGTGG - Intronic
966862012 3:184235848-184235870 GAGGTGTACATGACTGTGTGTGG - Intronic
966862016 3:184235878-184235900 GAGGTATACATGACTGTGTGTGG - Intronic
966862024 3:184235936-184235958 GAGGTACACATGACTGTGTGTGG - Intronic
967327519 3:188256856-188256878 GAGGTACACATGCATACGTGTGG + Intronic
967970826 3:194998259-194998281 GAGGAATAGATGAATATATGTGG - Intergenic
969758165 4:9163592-9163614 TAGGTACTCATAACTATGTGTGG - Intergenic
970470401 4:16372657-16372679 GAGGGGCACCTGCCTATATGAGG + Intergenic
972055185 4:34793381-34793403 GAGGTACATATTTCTATAGGAGG + Intergenic
972212415 4:36854965-36854987 GAGGGGCACATGCCTGTATGAGG - Intergenic
973013805 4:45110507-45110529 GAGGGACACCTGCCTGTATGAGG + Intergenic
973326080 4:48863442-48863464 GGGGTACACACGAATATATATGG + Intergenic
974691266 4:65300358-65300380 GTTGTACACATGACCATCTGAGG + Intergenic
975751041 4:77524112-77524134 GAGGGGCACCTGCCTATATGAGG + Intronic
975819192 4:78252591-78252613 GAGGTTCACATGGCTATCGGGGG + Intronic
977633537 4:99269983-99270005 GAGGGGCACATGGCTGTATGAGG + Intergenic
977950915 4:102969247-102969269 GAGGGACACCCGGCTATATGAGG - Intronic
978688568 4:111479941-111479963 GATGGACACATGACTCAATGAGG - Intergenic
979258378 4:118627294-118627316 TAGGTACACATGACGATACTTGG + Intergenic
979329972 4:119413265-119413287 TAGGTACACATGACGATACTTGG - Intergenic
979487561 4:121285531-121285553 GAGGGGCACCTGCCTATATGAGG - Intergenic
979516635 4:121616962-121616984 GAGGGGCACGTGCCTATATGAGG - Intergenic
980835098 4:138181708-138181730 GAGCTACAAAAGACTGTATGAGG - Intronic
983183608 4:164676644-164676666 GAGGGGCACCTGACTATATGAGG - Intergenic
984124833 4:175795275-175795297 GAGGTACCTATGGCTATCTGAGG + Intronic
985526950 5:409375-409397 GATGTACACTTGCCTTTATGTGG + Intronic
987619125 5:20317505-20317527 GTAGTACACATATCTATATGGGG + Intronic
989614681 5:43328254-43328276 GAGGGGCACCTGGCTATATGAGG + Intergenic
989670339 5:43909433-43909455 GAGGGGCACCTGCCTATATGAGG - Intergenic
990927286 5:61041369-61041391 GAGGTACTAATGACTATTTGAGG + Intronic
993645812 5:90459724-90459746 GTGCTACACATGTATATATGTGG + Exonic
993984718 5:94583788-94583810 GAGGGGCACCTGCCTATATGAGG - Intronic
994528460 5:100935461-100935483 GAGGGACACCTGGCTGTATGAGG + Intergenic
995037607 5:107552945-107552967 GGGGTAAACAAGACAATATGAGG + Intronic
995642913 5:114278230-114278252 GAGGGACACCTGCCTGTATGAGG + Intergenic
996428370 5:123340542-123340564 GAGGTTCAAGTGACAATATGAGG + Intergenic
996514957 5:124358998-124359020 GAGGGACACCTGGCCATATGAGG - Intergenic
996703518 5:126473600-126473622 GAGGTACATGTGTATATATGAGG - Intronic
998942579 5:147300664-147300686 GAAGTGCATATGATTATATGAGG - Intronic
999114794 5:149153339-149153361 GAGGTAGAAATGACCAGATGTGG - Intronic
1000145120 5:158446591-158446613 GAGGGGCACCTGCCTATATGAGG + Intergenic
1000412263 5:160946463-160946485 GAGGTGCACCTGGCTGTATGAGG + Intergenic
1002366594 5:178717327-178717349 GAGGTACAGATGACTATGCCAGG + Intronic
1003783621 6:9457907-9457929 CAGGTACACATGAAGCTATGTGG - Intergenic
1003831926 6:10021323-10021345 GAGGTGCACCTGCCTGTATGAGG + Intronic
1004011126 6:11688564-11688586 GATGTACACATGAATAGAAGAGG + Intergenic
1008094807 6:47328570-47328592 GAGGGGCACCTGCCTATATGAGG - Intergenic
1009852410 6:69214293-69214315 TAGTAATACATGACTATATGAGG + Intronic
1010997603 6:82551385-82551407 GAGGGGCACCTGCCTATATGAGG + Intergenic
1014899600 6:126946712-126946734 TATGTACACATGAGTGTATGGGG - Intergenic
1016325438 6:142896133-142896155 GAAGTTCAGATTACTATATGTGG + Intronic
1017935616 6:159002204-159002226 TAGATACACATAACTATTTGTGG - Intergenic
1018175731 6:161178023-161178045 GAGGGGCACCTGACTGTATGTGG + Intronic
1018748832 6:166783754-166783776 GATGTGCACATGTGTATATGTGG - Intronic
1020320092 7:6933553-6933575 TAGGTACTCATAACTATGTGTGG + Intergenic
1021119725 7:16785303-16785325 TTGGTACAAATGATTATATGTGG + Intergenic
1025034157 7:55582567-55582589 GAGGGACACCTGGCTGTATGAGG + Intergenic
1027727788 7:81829414-81829436 GAGGGGCACTTGCCTATATGAGG + Intergenic
1028234934 7:88349013-88349035 TAGGTATACATGAATAAATGGGG + Intergenic
1028691997 7:93663423-93663445 GAGGGGCACCTGCCTATATGAGG + Intronic
1029017633 7:97330481-97330503 GAGGGGCACCTGCCTATATGAGG - Intergenic
1029023531 7:97390415-97390437 GTTGTACACATGCCTATCTGAGG - Intergenic
1031767198 7:125795529-125795551 GAGGTAGAAATGATTATATTGGG - Intergenic
1032231738 7:130080315-130080337 GAGGTCCAAATGACTTCATGGGG - Intronic
1034898203 7:154891086-154891108 CAGGTACACATGACTACGTCCGG - Intronic
1036093642 8:5697960-5697982 TAGATACACATGATTATATATGG - Intergenic
1038675003 8:29615393-29615415 GAGGAGCACATGACTATCAGAGG - Intergenic
1038952970 8:32435832-32435854 CAGGTAAACATAACTATATTAGG - Intronic
1040042675 8:42932084-42932106 GATGTACCAATGACTACATGAGG - Intronic
1041031345 8:53738578-53738600 TAGGTGCACATGACTAAGTGTGG - Intronic
1041217639 8:55616474-55616496 GAGGGACACTTGACTATATGAGG - Intergenic
1041436385 8:57846610-57846632 GAGGTAAACATGTTTAAATGAGG - Intergenic
1042443258 8:68852441-68852463 GAGGTTCCCATGACTTTATCAGG + Intergenic
1043133170 8:76487641-76487663 AAGCTACACATGACTGTATTGGG - Intergenic
1043190774 8:77220136-77220158 GAGGTTAACATGACTATTTTGGG + Intergenic
1043927928 8:86059080-86059102 CAGGCACACATCACTATGTGTGG + Intronic
1044596964 8:93969213-93969235 GAGGGGCACCTGCCTATATGAGG + Intergenic
1046609873 8:116411077-116411099 GAGGGGCACCTGACTGTATGAGG - Intergenic
1052755385 9:32535720-32535742 GAGGTACACAACACAATATTTGG - Intergenic
1055389024 9:75798551-75798573 GAGGTACACTTAATTAAATGAGG + Intergenic
1057082215 9:92181428-92181450 GGGGTACAGATGACTCTGTGAGG + Intergenic
1058942965 9:109831240-109831262 GAGGCACACATCGCTATAAGTGG - Intronic
1059506644 9:114805230-114805252 TAGATACACATTCCTATATGTGG - Intronic
1061113435 9:128592053-128592075 GAGGGACACAGGGCAATATGGGG - Intronic
1187248303 X:17574064-17574086 GAGGGGCACCTGCCTATATGAGG + Intronic
1187705359 X:22004838-22004860 GAGGGGCACCTGCCTATATGAGG + Intergenic
1189017622 X:37300958-37300980 GAGGGGCACCTGCCTATATGAGG + Intergenic
1190660333 X:52648513-52648535 GAGTTACACATGCCTAAATTAGG + Intronic
1190797905 X:53760996-53761018 CAGGCACACATTTCTATATGCGG - Intergenic
1190917254 X:54820214-54820236 CAGGCACACATTTCTATATGCGG + Intergenic
1190970708 X:55344413-55344435 GAGGGACACCTGCCTGTATGAGG - Intergenic
1191084346 X:56547954-56547976 GAGGGACACCTGCCTATATGAGG - Intergenic
1191701994 X:64052824-64052846 GAGGTGCAGATAACTTTATGAGG - Intergenic
1192825976 X:74696444-74696466 GAGGGGCACCTGCCTATATGAGG - Intergenic
1192997419 X:76527227-76527249 GAGGGACACCTGCCTCTATGAGG + Intergenic
1193641028 X:84009561-84009583 GAGGGGCACCTGACTATATTAGG - Intergenic
1193806623 X:86002998-86003020 GAGGAGCACCTGCCTATATGAGG - Intronic
1194130963 X:90081195-90081217 GTTGTACACATGCCCATATGAGG + Intergenic
1195900047 X:109788182-109788204 AAGGTACACATATTTATATGAGG - Intergenic
1195934285 X:110110220-110110242 AAGGTATACATGAATATTTGTGG - Intronic
1196094577 X:111785150-111785172 GAGGGACAGCTGCCTATATGAGG - Intronic
1199292402 X:146119596-146119618 GAGGGACACCTGTCTGTATGAGG - Intergenic
1199504138 X:148542732-148542754 GAGGAACTCATAAATATATGAGG - Intronic
1199508317 X:148591271-148591293 AAGGAACACTTGACTATATGTGG + Intronic
1199560209 X:149154059-149154081 GAGGCAAACATAACTAAATGGGG - Intergenic
1201185966 Y:11403041-11403063 GAGGGACACCTGGCTGTATGAGG - Intergenic
1202038940 Y:20663084-20663106 GTGGTCCACATGACTTAATGTGG + Intergenic