ID: 964500820

View in Genome Browser
Species Human (GRCh38)
Location 3:157346451-157346473
Sequence GTTTCTAAGTTGAAATTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 265}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964500818_964500820 -4 Left 964500818 3:157346432-157346454 CCAAATGTTTGAAAGACCAGTTT 0: 1
1: 0
2: 0
3: 25
4: 524
Right 964500820 3:157346451-157346473 GTTTCTAAGTTGAAATTAGATGG 0: 1
1: 0
2: 1
3: 17
4: 265
964500816_964500820 -2 Left 964500816 3:157346430-157346452 CCCCAAATGTTTGAAAGACCAGT 0: 1
1: 0
2: 0
3: 20
4: 194
Right 964500820 3:157346451-157346473 GTTTCTAAGTTGAAATTAGATGG 0: 1
1: 0
2: 1
3: 17
4: 265
964500817_964500820 -3 Left 964500817 3:157346431-157346453 CCCAAATGTTTGAAAGACCAGTT 0: 1
1: 0
2: 1
3: 16
4: 205
Right 964500820 3:157346451-157346473 GTTTCTAAGTTGAAATTAGATGG 0: 1
1: 0
2: 1
3: 17
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964500820 Original CRISPR GTTTCTAAGTTGAAATTAGA TGG Intronic
905471171 1:38193201-38193223 GCTTCTAAGCTGACATTTGAAGG + Intergenic
905704204 1:40041862-40041884 GTTTTTAAGATGAATTTTGAAGG + Intronic
905844357 1:41215618-41215640 ATTTCTGAGTTAAAATTTGAAGG - Intronic
907098569 1:51805526-51805548 GTATCAACGGTGAAATTAGATGG + Exonic
907594509 1:55706825-55706847 GTTTCTAAGATGAAACAAGGAGG + Intergenic
909503903 1:76365657-76365679 TTTTCTAAGATGAATTTACAAGG + Intronic
909923861 1:81415209-81415231 GTTTATATGTTGCAATTAAAAGG + Intronic
910542417 1:88375534-88375556 GTGTCTAAGTTGAAACTACATGG + Intergenic
910825206 1:91399520-91399542 AATTCTAAGTTGAGGTTAGATGG - Intronic
911111685 1:94195021-94195043 GTTTCTAAATGATAATTAGAGGG + Intronic
911933641 1:103937879-103937901 GTTTCTGTGTAGAGATTAGAAGG - Intergenic
916733186 1:167584314-167584336 GTTTGTAAATTGAGATTTGAGGG - Intergenic
916928010 1:169543413-169543435 GTTGCTTAGTGGAGATTAGAGGG + Intronic
917775129 1:178325802-178325824 GTTGATAAGTTAAAATTAGCTGG + Intronic
917987954 1:180340291-180340313 GCTGCTAGGTTGAAAATAGAAGG + Intronic
919076990 1:192825672-192825694 GGTTTTTAGTTGAAATTAGTGGG + Intergenic
919136481 1:193514441-193514463 TTTTCTAAGATCAAATTATATGG - Intergenic
924636803 1:245795829-245795851 GTATTTAAGCTGAAATTAAAAGG - Intronic
924636806 1:245795880-245795902 GTATTTAAGCTGAAATTAAAAGG - Intronic
924745730 1:246831921-246831943 GTTTCTAAGAAAAAATTAGGAGG + Intergenic
1063992255 10:11578803-11578825 GTTTTTAAGTTGAAATAGAAAGG - Intronic
1064036388 10:11916783-11916805 GTTTCTTAGTTGCAAATGGAAGG - Intergenic
1064152350 10:12875332-12875354 GTCTAAATGTTGAAATTAGAGGG + Intergenic
1068159579 10:53246758-53246780 GTTACTCAGTTGAAATATGAAGG + Intergenic
1068313083 10:55304496-55304518 GTTTTTAAGTTGTACTTAGTGGG + Intronic
1070896451 10:79986499-79986521 GTTTCTATGGTGAAATAGGAAGG + Intergenic
1071415561 10:85437718-85437740 GTTTTTGAGTTGAGTTTAGAAGG - Intergenic
1073969958 10:109036460-109036482 ACATGTAAGTTGAAATTAGATGG + Intergenic
1076117483 10:127910300-127910322 GTTTCTAAGATGGAAATAAAGGG - Intronic
1079436804 11:20462726-20462748 TTTTCTATGTTGAATTTACATGG + Intronic
1079647548 11:22884920-22884942 GTTTTTAAGTTGTACTTAGCTGG - Intergenic
1079876041 11:25858566-25858588 GTTTCTAAATCCAAATCAGAAGG + Intergenic
1080456347 11:32423102-32423124 TTTTCTAGGTAGAAATTAGGGGG + Intronic
1082699185 11:56406924-56406946 GTTTATTAGTGGACATTAGAGGG + Intergenic
1082861683 11:57863151-57863173 GTTTATAAGTTAAAAGTAGGTGG + Intergenic
1085029670 11:73263317-73263339 ATCTCTCAGTTTAAATTAGATGG + Intergenic
1086235564 11:84626215-84626237 GTTTCTAAATTTACATTAGGTGG + Intronic
1087294990 11:96361299-96361321 ATTTTTAAGTTGAAACAAGAGGG + Intronic
1089234658 11:117013161-117013183 GTTTCTAAGTTAAAGTCAGAAGG + Intronic
1089810021 11:121124039-121124061 GTTTCTAATTTTAAATAGGATGG - Intronic
1090902991 11:131048843-131048865 GTTTTGAAGTAGAAATTAGAGGG - Intergenic
1091416826 12:295157-295179 GTATCTAAGTTGAAAAAAAAAGG - Intronic
1094683955 12:32691941-32691963 GCTTCTAAATTGAAATAGGAGGG + Intronic
1095254057 12:40012966-40012988 GTTTCTAAGTTCAAGTGAGTTGG + Intronic
1097278984 12:57832877-57832899 ATTTCTATGCTGAAATTGGAGGG + Intronic
1097772791 12:63608113-63608135 GTGGCTGAGTTCAAATTAGAAGG + Intronic
1097850788 12:64407621-64407643 GCTTCTAAGTTGAATTTCAAAGG + Intronic
1099420204 12:82448721-82448743 GTGGTCAAGTTGAAATTAGAAGG + Intronic
1099426412 12:82529164-82529186 GTTCTTATGTTGAAAGTAGAGGG - Intergenic
1100412492 12:94334944-94334966 GTTTCTAAGTCTTAACTAGATGG - Intronic
1100991150 12:100252764-100252786 GTTTTTAACATGAAATTATATGG + Intronic
1102863375 12:116355415-116355437 GATTCTAAGAAAAAATTAGAAGG + Intergenic
1103004984 12:117413938-117413960 GTTTCTAAGCTGAGATCTGAAGG - Intronic
1106829343 13:33562487-33562509 GTTTCTCATCTGAAATTATATGG + Intergenic
1107279758 13:38720170-38720192 GTTTGTAAGCCTAAATTAGAGGG - Intronic
1107385987 13:39909930-39909952 GTTTCTAATTTTAAATAAGGTGG - Intergenic
1108770096 13:53689371-53689393 GTTTTTAACTTTAAATCAGAAGG - Intergenic
1109083190 13:57933969-57933991 TTTTCTAAGTTAAACTTGGAAGG - Intergenic
1109207140 13:59495198-59495220 GTTTCTTAGTGGAAATTCAAAGG - Intergenic
1111563783 13:89988356-89988378 GTATCTGAGTTGTAATTCGATGG - Intergenic
1113290372 13:108899463-108899485 GTTTAGATGTTGAAGTTAGAAGG + Intronic
1114135934 14:19850717-19850739 GGTTCTTACTTGAAATTAAATGG + Intergenic
1114358343 14:21940728-21940750 GGTTTTGAGTTGAAATCAGAGGG - Intergenic
1114408930 14:22482488-22482510 GTTTAAAAGTGGAAATTTGAGGG - Intergenic
1115711904 14:36059954-36059976 GTTTCCAAGTGTAAATAAGAGGG + Intergenic
1116537854 14:46058289-46058311 ATTTCTAATTTGTAATCAGATGG + Intergenic
1120272029 14:82325331-82325353 GTTTCTTAGTTGAATTTATTAGG + Intergenic
1120464647 14:84841114-84841136 GTTTCTAAGATGAATTTACCTGG + Intergenic
1120468228 14:84888626-84888648 GTTTCTATGGTGAAATTTGATGG + Intergenic
1120517355 14:85486598-85486620 GATTCTCAGTTGTAATTACAGGG + Intergenic
1120547316 14:85827830-85827852 GATGCTAAGTTTAAAATAGAAGG - Intergenic
1121918041 14:97854173-97854195 TTTTCTAAACTGAGATTAGAAGG - Intergenic
1122678177 14:103434841-103434863 GCTTCTAATTTCAAATTGGAAGG + Intronic
1124427575 15:29574900-29574922 GTTTCTAAGTTGTCTTTAGTAGG - Intergenic
1125211951 15:37227147-37227169 GTTTATAATTTTAAATGAGATGG - Intergenic
1125275742 15:37989534-37989556 GTATCCAAGATGAAATTACAAGG - Intergenic
1125919853 15:43518879-43518901 GGTTCTGACTTGAAATTACATGG - Intronic
1126158709 15:45588541-45588563 GTTTTAAAGGTGAAATTACAAGG - Intronic
1128103238 15:65023110-65023132 TTTTCTAAGGGGAAATTAGGTGG + Intronic
1128190418 15:65688887-65688909 GTTTTTAAGTTGTAATCAGTGGG + Intronic
1128590618 15:68893363-68893385 GTTTCTAAGCAGAAGTTGGATGG + Intronic
1129238630 15:74238997-74239019 GTTTAGATGTTGAAACTAGAAGG + Intronic
1129647263 15:77448037-77448059 GTTTCTAAGTTCAAAATAACTGG - Intronic
1130155008 15:81342869-81342891 GTGTCTAAGTGAAAATTAGGAGG + Intronic
1130636133 15:85621998-85622020 GTTTCCAGTTTGAAATAAGATGG + Intronic
1130687888 15:86054938-86054960 GTATTTAAGTTAAAATTAAAGGG - Intergenic
1132926274 16:2430650-2430672 GTTTTCAAGTCCAAATTAGAAGG - Intronic
1135643813 16:24143803-24143825 GATTCTAACTTGAATTCAGATGG - Intronic
1141275719 16:82586103-82586125 ATCTGTAAATTGAAATTAGATGG + Intergenic
1142813950 17:2410946-2410968 GTTTCTAAGGTGGAATTGGTGGG + Intronic
1143733827 17:8896641-8896663 TTTTCAAAGTTGCAAATAGATGG + Intronic
1147364073 17:39948888-39948910 GTTTCTAACTTGATATAAGCAGG - Intergenic
1148931047 17:51127606-51127628 GTATCCAGGTTGAAGTTAGAAGG + Intergenic
1150909101 17:69369754-69369776 GGTTGTAAGATGAAATGAGAAGG + Intergenic
1150965576 17:69964257-69964279 ATTTATAAGTTTAAATTAAATGG - Intergenic
1153839941 18:8997937-8997959 GATGCTAGGTTGAAATTTGATGG - Intergenic
1153854019 18:9127197-9127219 ATTTTTAGGTAGAAATTAGAGGG - Intronic
1154460326 18:14577363-14577385 GGTTCTTACTTGAAATTAAATGG + Intergenic
1155014935 18:21825628-21825650 GTAAATAAGTTGAAATTAGTTGG + Intronic
1155868566 18:30997090-30997112 GATTCTAAGTTGTCATGAGAAGG + Intronic
1156794949 18:41033062-41033084 GTTTGTAAGTTCAAATGAAAAGG - Intergenic
1157658005 18:49411210-49411232 GTTTCTAGGTTGATATTATGTGG - Intronic
1158034687 18:53012708-53012730 GTTACTTAATTAAAATTAGAGGG + Intronic
1158333334 18:56387104-56387126 GTATCTAAAATGAAATCAGAAGG + Intergenic
1159618648 18:70611702-70611724 GTTTCTAATCTCAAATTAGTAGG - Intergenic
1159698907 18:71598675-71598697 GTTACTAAATAGAAATTATAGGG + Intergenic
1160175152 18:76587575-76587597 GTTTCTAAGTTGCAATTGTGGGG + Intergenic
1160441435 18:78895845-78895867 GTCTCTAAGTGGCACTTAGATGG - Intergenic
1167630700 19:50624852-50624874 GAGGCTAAGTTGAAAATAGAGGG - Intronic
925882751 2:8366682-8366704 GTTTTTAAATTAAAATTTGAAGG - Intergenic
926509495 2:13756830-13756852 GTTTTTATGTGGAAATTATAGGG + Intergenic
926812662 2:16770346-16770368 GTTTGAAAGCTGAAATAAGAAGG + Intergenic
926841399 2:17084650-17084672 GTGTTTAAGCTGAAATTTGAAGG - Intergenic
927483823 2:23475175-23475197 GTTTCTTAGTTTGGATTAGATGG + Intronic
929019995 2:37543819-37543841 TTTTCTAAGTTGATAATAAAGGG - Intergenic
930003814 2:46880538-46880560 GTTTCTGGGTTGAAATTAGAAGG + Intergenic
930669516 2:54133665-54133687 TTTTCCAAGTTGCAATTTGAAGG + Intronic
930682081 2:54267373-54267395 GTTTCTACTTTCAAATGAGAAGG + Intronic
932018294 2:68055839-68055861 ATTTCTATAGTGAAATTAGATGG + Intronic
933284047 2:80365233-80365255 GTTTCTAACATGAAATTCAAGGG + Intronic
934626075 2:95854207-95854229 GTTTCTAATTTAAAAAAAGAGGG - Intronic
934807496 2:97247108-97247130 GTTTCTAATTTAAAAAAAGAGGG + Intronic
934830014 2:97510079-97510101 GTTTCTAATTTAAAAAAAGAGGG - Intronic
934910022 2:98243622-98243644 GTTACTAAGTGTAAATTACATGG - Intronic
937643838 2:124243967-124243989 GTTTTTATGTTGACTTTAGAGGG + Intronic
937695062 2:124799821-124799843 CTTTCTAAGATAAAAATAGAAGG + Intronic
939406112 2:141758893-141758915 TTTTCTAGATTGAAATTTGAAGG - Intronic
939413476 2:141862239-141862261 GTTTCTGTGGAGAAATTAGAGGG - Intronic
941313145 2:163959546-163959568 GGTTCTAAGTTAGAATTATAGGG - Intergenic
942033950 2:171992538-171992560 GTCTTTATGTTAAAATTAGAAGG + Intronic
942618781 2:177825022-177825044 TTTTCTAAGTAGAACTTAGGGGG + Intronic
945126200 2:206513163-206513185 GTCTCTCACTTGAAATTAAAAGG + Intronic
945317747 2:208389035-208389057 GATTCTAATTAGAAATAAGAGGG + Intronic
945338018 2:208615976-208615998 TCTTCTAAGTTTAACTTAGAGGG + Intronic
945346647 2:208725805-208725827 TTTTCTAAGTTGTAATTATTTGG + Intronic
945957814 2:216102399-216102421 GTTGATATTTTGAAATTAGAAGG - Exonic
946440940 2:219695047-219695069 GTTTTTAAATTGAATTTAGAAGG - Intergenic
946807131 2:223482201-223482223 GTTTCTAAGATCAAATGACATGG - Intergenic
948001050 2:234567725-234567747 GTGTCGAAGCTGACATTAGAAGG - Intergenic
1169984299 20:11425475-11425497 GTGTCTTAGTTGAATTTTGAAGG + Intergenic
1170252101 20:14295178-14295200 GTTTCCAAGCTGAATTTAAATGG - Intronic
1170531854 20:17301084-17301106 CTTTCTAAATTGATTTTAGAAGG - Intronic
1171776865 20:29376733-29376755 GTTTATAAGTGGAAAAAAGAAGG - Intergenic
1172674510 20:36658650-36658672 GTTCCCAAGTTCAAACTAGAAGG + Intronic
1173529933 20:43761394-43761416 GTTTCTAGGGAGAAATGAGAAGG + Intergenic
1176813781 21:13575454-13575476 GGTTCTTACTTGAAATTAAATGG - Intergenic
1177672728 21:24254438-24254460 ATTTCTATGTTAAAATTTGAAGG + Intergenic
1177868306 21:26539359-26539381 GTTACTGTGTTGAAATCAGAGGG - Intronic
1178669285 21:34576681-34576703 GTTTCAAAGTTTAAACTGGATGG + Intronic
1179989089 21:44937111-44937133 GGAACTAAGTTGAAATCAGATGG - Intronic
1182747723 22:32618354-32618376 GTTTCCAAGCTGAAAGTGGATGG + Intronic
1184621861 22:45686057-45686079 GTTTCTGAGTAGAGATTATATGG + Intronic
1184624186 22:45710142-45710164 GCTTCTAGGTTGCAATAAGAAGG - Intronic
950904058 3:16521576-16521598 CTTTCTGAGTTGCATTTAGAGGG + Intergenic
952509978 3:34043281-34043303 GGTCCTAAGTTGGAATAAGAAGG + Intergenic
955946308 3:64197901-64197923 GTTTCCAAGTTAAAATTTCAAGG + Intronic
957088220 3:75702921-75702943 GTTTATAAGTGGAAAAAAGAAGG + Intergenic
958010922 3:87878570-87878592 ATCTCTAAGTAGAAATTAGGAGG + Intergenic
958612936 3:96450640-96450662 GTTGCAAAGTTTAAATGAGAGGG + Intergenic
960099234 3:113721489-113721511 GTTTTGCAGTTGAAGTTAGATGG - Exonic
960831564 3:121854950-121854972 TTTTCTAAGTTTAAATTTGGTGG + Intronic
961069976 3:123914390-123914412 GTTTTTCTGTTGAAACTAGAGGG - Exonic
961762305 3:129180493-129180515 AATTTTAAGTTGTAATTAGAAGG - Intronic
963406461 3:144869925-144869947 GTCTGTAGGTTGATATTAGAGGG + Intergenic
964213788 3:154256656-154256678 GTTTCCAAATAGAAATTAGCTGG + Exonic
964500820 3:157346451-157346473 GTTTCTAAGTTGAAATTAGATGG + Intronic
965328613 3:167340366-167340388 TTTACTAAGTGGAAATTTGATGG - Intronic
965870777 3:173262201-173262223 GTTTCTAAGTAGACTTGAGAGGG + Intergenic
966181254 3:177190622-177190644 GTTTCTTAGATGAAAATGGATGG - Intronic
968143958 3:196282129-196282151 GTTTCTCTGACGAAATTAGAGGG - Intronic
968356957 3:198116114-198116136 GTTTATAAGTGGAAAAAAGAAGG + Intergenic
968840531 4:3001888-3001910 GTTTCTAATTACAAATTAGGTGG + Intronic
969343069 4:6554376-6554398 GTTTCTATGGAGGAATTAGAGGG - Intronic
969563561 4:7964617-7964639 GTTTCTGAGTCGAACTGAGAAGG + Intergenic
971177513 4:24293825-24293847 GGTTTTAAGTTCAAAATAGAAGG - Intergenic
971273543 4:25173792-25173814 GAAACTAAGTTGAAATAAGAAGG - Intronic
971334543 4:25710653-25710675 TTTCCTAAGGTGAAATCAGAGGG + Intergenic
972621731 4:40753623-40753645 TTTTATAAGTTCAAATTATAAGG + Intronic
973031289 4:45344196-45344218 ATTTTAAAGTTGAAATAAGATGG + Intergenic
973777677 4:54258029-54258051 GACTCTAGGATGAAATTAGAAGG - Intronic
980494420 4:133572663-133572685 GTTTTTAAGTGGAAATAAAAGGG + Intergenic
981143357 4:141296879-141296901 GTATCTAAGTTGAAATCTGCAGG - Intergenic
981220763 4:142231000-142231022 GTTTCAAACTTGAATTCAGAAGG + Intronic
981982775 4:150815057-150815079 GTTCCTAAACTGAAACTAGAGGG + Intronic
982525606 4:156474080-156474102 GTTTTTAAGATCAAATTAGAAGG + Intergenic
982692244 4:158562084-158562106 TGTTTTAAGTTGAAATTAGTAGG + Intronic
983434491 4:167695098-167695120 TTTTCTAAGTTGGCATAAGAAGG - Intergenic
983782549 4:171689470-171689492 GCTTCTAATTTGAAATTAGCAGG + Intergenic
984134551 4:175919438-175919460 ATTTCTAACTTAAAAATAGAGGG + Intronic
986753083 5:10807873-10807895 GTTTCTAAGCTGAAAATAGCAGG + Intergenic
987150193 5:15030720-15030742 ATTTCTAAGCTGAAATCACAAGG - Intergenic
987220499 5:15786206-15786228 GTTTTGAAATTAAAATTAGATGG + Intronic
989064729 5:37448496-37448518 GTGTCTATGTTTAAATTACAAGG + Intronic
989303917 5:39929261-39929283 GATTTTAAGTTAAAACTAGAAGG + Intergenic
989426485 5:41301863-41301885 GTTTCTAGGTTGAAACTATTAGG + Intergenic
990333820 5:54753022-54753044 ATTTATAACTTGAACTTAGAGGG - Intergenic
993669701 5:90745680-90745702 ATTTTTAAGTTGAACTTTGAAGG - Exonic
994202700 5:96996002-96996024 CTTACTAACTTGATATTAGAAGG + Intronic
994418528 5:99504326-99504348 GTGTCTATGTTTAAATTACAAGG + Intergenic
994461429 5:100070815-100070837 GTGTCTATGTTTAAATTACAAGG - Intergenic
994740870 5:103617102-103617124 GTATTTAATATGAAATTAGAAGG + Intergenic
994852460 5:105073382-105073404 GTTTTTAAGTAGGAATTAGTTGG + Intergenic
999412962 5:151368436-151368458 ATTTCTTAGTTGACATTACATGG + Intergenic
1000146749 5:158460767-158460789 TTTTCTTTGTTGCAATTAGAAGG - Intergenic
1000657275 5:163894980-163895002 GTTTCTGAGCTGGAAGTAGAGGG + Intergenic
1002101916 5:176862008-176862030 GGTTTTCAGTTAAAATTAGAAGG + Intronic
1003286809 6:4741556-4741578 GTTTCTAAGTTCAAATCAGCAGG + Intronic
1004129821 6:12908926-12908948 TTTGCTAAATTGAAATTTGACGG - Intronic
1005312024 6:24567898-24567920 GTTTCTAAGGGGAAATTGGGAGG - Intronic
1007242925 6:40439890-40439912 GTTTCTAATTTGAAGGTAGGGGG + Intronic
1008158467 6:48047289-48047311 GTTTCTAAGTGATAATTAGAGGG - Intronic
1009774560 6:68189268-68189290 GTTTGTAAAATGAATTTAGAGGG - Intergenic
1011705207 6:89994428-89994450 TCTTCTAACTTTAAATTAGAAGG + Intronic
1013573275 6:111451709-111451731 ATTTCTAAGTTGTCATTAGGTGG - Intronic
1013751109 6:113407394-113407416 GTTTATGATTTGAAATTAGTTGG - Intergenic
1014915367 6:127140662-127140684 ATTTCTAAGTAAATATTAGAAGG - Intronic
1015739598 6:136439617-136439639 GTTTGTAAGATGAAAAAAGAGGG - Intronic
1015932883 6:138380388-138380410 GGTTTTGACTTGAAATTAGATGG - Intronic
1016164698 6:140926169-140926191 TTTTCTTAGTTGAAAGAAGAAGG + Intergenic
1016177918 6:141102896-141102918 GTGTCTTACTTGAAATTTGATGG + Intergenic
1016393014 6:143593385-143593407 GTATCTCAGTTGAAACTGGAAGG + Intronic
1016983635 6:149877241-149877263 GTTTTGAAGTTGCATTTAGAAGG - Intergenic
1017280345 6:152617082-152617104 GTTCCTAAGTAGATATTTGAGGG - Intronic
1018220714 6:161575843-161575865 TTTTCTAAGTTGTACTTAGGGGG - Intronic
1018408931 6:163521313-163521335 ATTTTTCAGTTGAAATTAGAAGG + Intronic
1020601557 7:10280631-10280653 GTTTATATATTCAAATTAGAGGG - Intergenic
1022365440 7:29710551-29710573 GTGGCTGAGTTCAAATTAGAAGG - Intergenic
1022696131 7:32707935-32707957 GTGGCTGAGTTCAAATTAGAAGG + Intergenic
1022749157 7:33205096-33205118 ATTTCTAAGAGGAAACTAGATGG - Intronic
1022932353 7:35131807-35131829 GTGGCTGAGTTCAAATTAGAAGG + Intergenic
1024789475 7:52948025-52948047 GTTTCTGAGTTGTAATCAAAGGG + Intergenic
1026304529 7:69128941-69128963 TTTTCTTAGTTGAAATTACCTGG + Intergenic
1028269067 7:88765179-88765201 ATTTCATAATTGAAATTAGAGGG + Intronic
1028608620 7:92683064-92683086 GTTTCTATGGTGAAAGCAGAGGG - Intronic
1028951226 7:96637326-96637348 GTTTCAGAGCTGAAATGAGAAGG - Intronic
1029143030 7:98425071-98425093 GGTTCTATCTTGAAATTATAAGG - Intergenic
1031304243 7:120104253-120104275 GACATTAAGTTGAAATTAGATGG + Intergenic
1033387474 7:140892470-140892492 GTTTCTAAGCTCAAATGAGGGGG - Intronic
1033509707 7:142047692-142047714 TTTTCCAATTTGAAATTTGATGG + Intronic
1035309909 7:157960492-157960514 TTTTTAAAATTGAAATTAGATGG - Intronic
1035961665 8:4144945-4144967 ATTTCTAACTTGAAAACAGAAGG + Intronic
1036121059 8:6018262-6018284 GTTTCTAAGTTTTGAATAGAAGG - Intergenic
1036948984 8:13123093-13123115 GTTTCTAAGTGGAGGATAGAGGG - Intronic
1037174983 8:15936259-15936281 TTTTCTAACTTGAAATCAGATGG + Intergenic
1037239297 8:16759447-16759469 GCATCTAACTTGAAAATAGAAGG - Intergenic
1038025213 8:23582344-23582366 GCTTTTTAGATGAAATTAGAAGG + Intergenic
1038833642 8:31093315-31093337 TTTTCTGAGATAAAATTAGAAGG + Intronic
1041474133 8:58244535-58244557 GTTTCTAACTTAAAAATAGAAGG - Intergenic
1042899874 8:73714390-73714412 GGGTCTAATTTGAAAATAGAGGG - Intronic
1044053969 8:87544620-87544642 TTTTCTCAGTAGAAATCAGATGG + Intronic
1044153267 8:88809440-88809462 GTTTCTAAGTTAGAATAAAAGGG + Intergenic
1045289853 8:100823722-100823744 GTGTCTCAGTGGAAAATAGATGG - Intergenic
1045654518 8:104373241-104373263 GTTTCTAAGATGACATCAGATGG + Intronic
1046028655 8:108756355-108756377 CTTTCTAACTTAAAAATAGAAGG + Intronic
1046489150 8:114925149-114925171 GTTTGCAATTTTAAATTAGAAGG - Intergenic
1046503263 8:115106120-115106142 GTTTCTAATTTGAAATTCCATGG + Intergenic
1047144018 8:122176547-122176569 ATTTCTAATTTGAAATTGTAGGG + Intergenic
1047471413 8:125177130-125177152 GTCTCTATGCTGAAGTTAGAAGG + Intronic
1047754611 8:127908906-127908928 GGTTCAAAGCTGAAATTGGATGG - Intergenic
1052448610 9:28596800-28596822 GTTTCAAAGTTGTAATTAATGGG - Intronic
1058605239 9:106714493-106714515 GTCTCTCATTTGAAATTGGATGG - Intergenic
1059924799 9:119198173-119198195 GTTTTTAAGTTAAAATAAAATGG + Intronic
1060903239 9:127280459-127280481 GTCTCTTAGCTAAAATTAGATGG + Intronic
1186104017 X:6186849-6186871 TTTTCTAAGATTTAATTAGATGG - Intronic
1186859823 X:13661323-13661345 TCTTCTAAGGAGAAATTAGAAGG - Intronic
1186950449 X:14618890-14618912 GTTTCTGACTTGAAAATGGAAGG - Intronic
1189163865 X:38839584-38839606 GTTTTTAAGTGGAAGTAAGAAGG + Intergenic
1190099035 X:47506509-47506531 GTTGGTGAGTTGAAATTGGATGG + Intergenic
1190497982 X:51045420-51045442 GTGATTAAGTTGAAATTGGAAGG + Intergenic
1190508394 X:51152142-51152164 GTGATTAAGTTGAAATTGGAAGG - Intergenic
1194697720 X:97075990-97076012 TTTTCTCATTTGAAATTACAGGG + Intronic
1195653022 X:107305770-107305792 TTTTCCAAGTTGAAATGAAAGGG + Intergenic
1196143072 X:112286663-112286685 GTTTCTGACTTGAAATTGGATGG - Intergenic
1197150198 X:123212336-123212358 ATTTCTGATTTGAAAATAGAAGG - Intronic
1197475382 X:126916711-126916733 TTTTATAATTTGAAATTACAAGG + Intergenic
1197521361 X:127501533-127501555 GTTTCTGATTTGAAATTACTTGG - Intergenic
1198065524 X:133092849-133092871 GTTTCTAAATTCAATCTAGAAGG + Intronic
1198373051 X:136010349-136010371 GCTTGAAAGATGAAATTAGAGGG - Intronic
1198625647 X:138569982-138570004 GTATTTAAGAAGAAATTAGATGG - Intergenic
1198835503 X:140800560-140800582 GTTTGTAAGCTGAATTTAGAGGG - Intergenic
1199904449 X:152210778-152210800 GTTTTTAAGGTGGAATTATAAGG - Intronic
1201610060 Y:15831457-15831479 TTTTATAAGTTTAAATTTGAAGG + Intergenic
1201613991 Y:15875274-15875296 GTTTCTGAGTTGAAATATAAAGG + Intergenic
1201616377 Y:15904506-15904528 GTTTCTGAGTTGAAATATAAAGG - Intergenic