ID: 964501925

View in Genome Browser
Species Human (GRCh38)
Location 3:157357469-157357491
Sequence CTTACAATGCAGATGGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964501925_964501927 24 Left 964501925 3:157357469-157357491 CCTTTGTCCATCTGCATTGTAAG 0: 1
1: 0
2: 1
3: 18
4: 152
Right 964501927 3:157357516-157357538 AGAGTCTTGCTCTGTTGCCCAGG 0: 6551
1: 32159
2: 84434
3: 153956
4: 178272
964501925_964501928 28 Left 964501925 3:157357469-157357491 CCTTTGTCCATCTGCATTGTAAG 0: 1
1: 0
2: 1
3: 18
4: 152
Right 964501928 3:157357520-157357542 TCTTGCTCTGTTGCCCAGGCTGG 0: 19870
1: 65461
2: 149698
3: 191149
4: 205218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964501925 Original CRISPR CTTACAATGCAGATGGACAA AGG (reversed) Intronic
903316760 1:22514069-22514091 GTTACAATGCAGATTGTCAGCGG + Intronic
903726121 1:25446593-25446615 TTTAAAATGCAGATGGGCCACGG + Intronic
905681629 1:39876479-39876501 CTTACAATGGAGGTGAACCAAGG + Intronic
906329315 1:44871487-44871509 CTATACATGCAGATGGACAAGGG - Intronic
907427897 1:54392618-54392640 GTTTTAATGAAGATGGACAAGGG - Intronic
907644333 1:56226777-56226799 CTTAATATGCAGATGGACATTGG - Intergenic
908136856 1:61141988-61142010 CCTAAAATGCAGCTGGCCAAAGG + Intronic
908472592 1:64458845-64458867 ATTGCAGTGCAGATGGACAAAGG + Intergenic
908473507 1:64468065-64468087 CATAGGATGCAGATGGACAGCGG + Intergenic
908493959 1:64675856-64675878 GTTACTATGCAGAAGGTCAATGG - Intronic
909084743 1:71157287-71157309 CTTACAATGCTTATAGACCAGGG - Intergenic
909142389 1:71884815-71884837 CTTTAAATTCACATGGACAAAGG + Intronic
909962540 1:81864598-81864620 TTTACAATGAAGTTGGAAAATGG + Intronic
912300530 1:108511458-108511480 CTTCCAATGCAGCTGAAAAACGG + Intergenic
912658794 1:111510305-111510327 CATACAAAGCAGAGGGACTAAGG - Intronic
917488862 1:175480155-175480177 CTGACTATGCAGCTGGAGAATGG - Intronic
919426520 1:197439140-197439162 CTTAAAATGGAGTTGGTCAATGG + Intronic
920827805 1:209438056-209438078 CTTAGAAGGCAGATGGTCACAGG - Intergenic
921126475 1:212182435-212182457 CTTACATGGCAGAGGGCCAAGGG + Intergenic
923059184 1:230454948-230454970 CTTTCAAAGGAGATGGAAAAAGG - Intergenic
1063627495 10:7704105-7704127 CTTACATTGGAGATGGCTAAGGG - Intronic
1064485739 10:15787263-15787285 CTTACAATGCAGGTGTACCAAGG + Intronic
1066261253 10:33731663-33731685 TTTACAATGCAGATAAACAAAGG + Intergenic
1069958919 10:72068296-72068318 CTTACACTGCACATGGGGAAAGG + Exonic
1070247032 10:74742531-74742553 CTTGCAAAGCAGAAGGAAAAAGG + Intergenic
1071353649 10:84771281-84771303 GTAACAATGGAGATGGGCAAAGG + Intergenic
1073740575 10:106401397-106401419 CATAAAAGGCATATGGACAAAGG + Intergenic
1073794708 10:106975033-106975055 CTTACAACACAGAAGGCCAAAGG + Intronic
1073997006 10:109326984-109327006 CTTACAGTGGAGAGGGAGAAGGG - Intergenic
1074790357 10:116880451-116880473 CTAACCATGCAGATTTACAAAGG - Intronic
1076425067 10:130361794-130361816 CTCTGCATGCAGATGGACAATGG - Intergenic
1077700487 11:4436968-4436990 CTTTAAATGCAGATGGTGAAGGG + Intergenic
1079166630 11:18050110-18050132 CTTGCTTTGAAGATGGACAAAGG - Intergenic
1084927998 11:72529421-72529443 CTTACAATGCAGAAGTAGATTGG + Intergenic
1085558058 11:77443449-77443471 CTTACATTACAGTTGGATAAGGG - Intronic
1087603105 11:100340587-100340609 CTTACAATGGAGCTGGATATGGG + Exonic
1089106763 11:116014516-116014538 CTCACAATGAAGATATACAATGG - Intergenic
1091011453 11:132004961-132004983 CTTACCACGCAGAATGACAACGG + Intronic
1091326060 11:134688987-134689009 TTTAAAATGCACATGGAAAATGG - Intergenic
1092243255 12:6848575-6848597 CTTATAAAGCAGCTGGATAAAGG + Intronic
1093015258 12:14148712-14148734 ATTACAAATCAGATGGAAAAAGG + Intergenic
1093602056 12:21039333-21039355 CTTAAAAGGGAGATGGAGAAAGG - Intronic
1094615295 12:32030800-32030822 ATTACAATGCAGATGACTAAAGG - Intergenic
1097064357 12:56309820-56309842 CTTATAGTCCAGATTGACAATGG + Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107317296 13:39146872-39146894 GTTAGAATGCACATGGACTATGG + Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108348613 13:49569969-49569991 CTTACAAAACAGATGGAGAAAGG + Intronic
1109036741 13:57272324-57272346 CTAACAATGCATATTGAGAATGG + Intergenic
1110969737 13:81746468-81746490 CTTACAAAGCAGAGGGATATTGG - Intergenic
1112262996 13:97894754-97894776 CCTTCTATGCACATGGACAATGG + Intergenic
1112633891 13:101193494-101193516 ATTACTTTGCACATGGACAAAGG - Intronic
1112687672 13:101850085-101850107 CTTACATTGCATTTGGATAATGG - Intronic
1113119939 13:106915447-106915469 CTTACAATGTGGAGGGAAAAAGG + Intergenic
1113708798 13:112450932-112450954 TTTAGAATACAGATGGCCAAAGG - Intergenic
1115129130 14:30032586-30032608 CATAGAATGCAGGAGGACAAAGG - Intronic
1115737266 14:36346641-36346663 CTTGAAATGCAACTGGACAATGG + Intergenic
1119019557 14:71096826-71096848 GTTAGAAGGCAGATGGAAAAAGG + Intronic
1119140445 14:72262787-72262809 CTCACATAGCAGATGGCCAAGGG + Intronic
1119772359 14:77228190-77228212 CTTACAAGAAAGATGGAGAAAGG + Intronic
1126336101 15:47587867-47587889 CTGACAATGCAAATGGAGAAAGG - Intronic
1126423281 15:48498592-48498614 TTCAGAATGCAGATGGAGAATGG + Intronic
1126469919 15:48998238-48998260 TTTAAAATGCAGCTGGATAAAGG - Intronic
1126740786 15:51774294-51774316 TTTAAAATGCAGATAGAAAAAGG + Intronic
1127736787 15:61848277-61848299 ATTACAATCCAGATGGTAAATGG - Intergenic
1137562796 16:49513751-49513773 CTTACAATCCATATGGCCAACGG + Intronic
1137882263 16:52062381-52062403 CTGGCAATGCAGATGGAAGAAGG - Intronic
1140801448 16:78491969-78491991 CTTAAAATGCACCTGGACCAGGG - Intronic
1141421085 16:83915948-83915970 CATGCAATGCAGAGGGACAAAGG + Exonic
1143975048 17:10823437-10823459 CTCACAATGCAGAAGGAACAAGG + Exonic
1146136724 17:30328474-30328496 CTTACAATTCAAAATGACAAAGG + Intronic
1149468637 17:56898923-56898945 CGTGCAATGCTGATGGACAGCGG + Intronic
1150534670 17:66023641-66023663 CTTACAAAGCAATTGCACAAAGG + Intronic
1158517134 18:58139974-58139996 CTTGCATTGCTGATGGACATTGG + Intronic
1159086236 18:63794850-63794872 CTTATCCTGCAGATAGACAAAGG + Intronic
1160605375 18:80045934-80045956 CTGACAACGCAGATGAAAAAGGG + Exonic
1163500136 19:17671349-17671371 CTCCCAAGGCAGATGGACAGGGG + Intronic
925512226 2:4640887-4640909 CATGGCATGCAGATGGACAATGG - Intergenic
927905863 2:26855786-26855808 CTTGCTCTGCAGAAGGACAAAGG - Intronic
930508314 2:52312696-52312718 CTTCCAATGCAGCTGAATAAAGG + Intergenic
931069028 2:58623418-58623440 CTAACATTTCAGATGCACAATGG - Intergenic
931511214 2:62997359-62997381 CTTTCAATGCTGATTGCCAATGG + Intronic
932220697 2:69996827-69996849 CTGAGAATGCTGATGGATAAGGG + Intergenic
933301518 2:80546085-80546107 CTTACAAGGCAGCTGGAGGAGGG + Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938150446 2:128878008-128878030 CTGACAATTTTGATGGACAATGG + Intergenic
940375427 2:152952812-152952834 ATTACAATCCAGATAAACAAAGG - Intergenic
943156835 2:184190478-184190500 CTGATAATGCAGATGAATAATGG + Intergenic
943736062 2:191355853-191355875 CTCACAATGGAGATGGAGGATGG + Intronic
943768695 2:191691814-191691836 TTTCCAATGCTGATGGAGAAAGG - Intronic
944057481 2:195538305-195538327 CTTCCAGTACAGATGGACTAAGG + Intergenic
944940316 2:204618089-204618111 CTTCCAATGCCCATGGACAGTGG + Intronic
946470179 2:219952633-219952655 CTTACAATTCTGATGGTCAAAGG + Intergenic
947288817 2:228548125-228548147 TCAACAAAGCAGATGGACAAAGG + Intergenic
948644900 2:239398397-239398419 CTCACAATGAAGCTGGAGAATGG + Intronic
1169753035 20:9014906-9014928 CTGACAAAACAGATGAACAAAGG + Intergenic
1170274111 20:14564437-14564459 CAAACAATGCATCTGGACAAAGG + Intronic
1170274422 20:14568285-14568307 CTGACACTGCAGAAGGCCAAAGG + Intronic
1170732780 20:18988856-18988878 CTTGCAATGCAAATGGACTTGGG - Intergenic
1172560016 20:35879273-35879295 CTTACAATACAGCTGCATAATGG + Intronic
1177571103 21:22888288-22888310 ATTAACATGCATATGGACAAGGG + Intergenic
1177702288 21:24654408-24654430 TTTAAAATGCAGCTGGACAGTGG - Intergenic
1180698712 22:17770194-17770216 CTTAAAATGCAGATGGACTTGGG - Intronic
1183523602 22:38310732-38310754 CTTATGATGCAGAGGGAGAAGGG + Intronic
951587929 3:24234333-24234355 CTTAAAATGCAGATAGCTAATGG + Intronic
952045331 3:29312039-29312061 TCTACCATGCAGATGGACTATGG - Intronic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
961395202 3:126582186-126582208 CTTACAACATAGATGGAAAATGG + Intronic
961719671 3:128884766-128884788 CTTACAATGGAAATCGGCAATGG - Intronic
962766895 3:138573791-138573813 TTTACAATGGAGGTGGACACTGG + Intronic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964332487 3:155619349-155619371 TTTACAATGCAGTTGAACAAAGG - Intronic
964501925 3:157357469-157357491 CTTACAATGCAGATGGACAAAGG - Intronic
965276441 3:166688986-166689008 CCTTCAATGAATATGGACAAAGG + Intergenic
966001152 3:174949949-174949971 GTTCCAATGCAAATAGACAATGG - Intronic
966412575 3:179658439-179658461 CTTACAATGCAGGTGGGGAGGGG - Intronic
966627369 3:182032864-182032886 CTTCTGATGCAGATGGCCAATGG - Intergenic
967762054 3:193237398-193237420 CATACAATGCATTTGGAAAAAGG - Intergenic
971189741 4:24416086-24416108 CTTAAAATGCAGATGGATACAGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
977666111 4:99649366-99649388 CTTGCCATGCAGCTGGGCAAAGG + Exonic
978434548 4:108669482-108669504 CTGACAATGCAGTGGGACAGTGG - Intergenic
981539241 4:145831765-145831787 CTTAAAATGCAGGAGGAAAAAGG + Intronic
986034725 5:3926651-3926673 CTGACAAAGAAGATGGAAAAGGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986797129 5:11223245-11223267 CCTTCAAGGAAGATGGACAAGGG - Intronic
988537794 5:32084395-32084417 CTTCCAATGCAGATGGTCACAGG + Intronic
991085164 5:62642221-62642243 CTGACATTGAAGATGGATAAAGG + Intergenic
992132899 5:73712329-73712351 CTCACAATTCACAAGGACAAAGG - Intronic
993752621 5:91689828-91689850 CTTACATGGCAGAAGGTCAAAGG + Intergenic
995550644 5:113277814-113277836 CTCACAATGCAGATGGCTGATGG - Intronic
1000405892 5:160888041-160888063 CATAAAAGGCATATGGACAAAGG + Intergenic
1002462185 5:179379656-179379678 CTTACAATGCAGATGCATAGTGG + Intergenic
1004871649 6:19911001-19911023 CTTATAATGATGATGGACAGAGG + Intergenic
1007215206 6:40231950-40231972 CTCACAAAGAAGATGGAAAAGGG + Intergenic
1009026190 6:58003080-58003102 CTCACAAGGCAGAAGGGCAATGG - Intergenic
1009201739 6:60754553-60754575 CTCACAAGGCAGAAGGGCAAGGG - Intergenic
1010749700 6:79604217-79604239 CTCAAAATCCACATGGACAAAGG + Intergenic
1013365377 6:109433735-109433757 CTTACATTGATGAAGGACAAGGG + Intronic
1015022177 6:128489859-128489881 CTGAAAATGCAGATGCAGAATGG - Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018083986 6:160286227-160286249 TTTACATTGCATATGTACAATGG + Intergenic
1018449330 6:163892487-163892509 CTTACAATGCAGTTGGAGAAAGG - Intergenic
1021197250 7:17687354-17687376 TCTACAATGAAGATGGACAAGGG + Intergenic
1027672353 7:81117715-81117737 CTTAGAATGCAGGAAGACAAGGG - Intergenic
1027760109 7:82266853-82266875 CTTACAATTTAGCTGGACATAGG - Intronic
1029209899 7:98898630-98898652 CTCAAAATACAGATGGGCAATGG - Intronic
1031144097 7:117978801-117978823 CTTTGAATGCAGGTGGACAGAGG + Intergenic
1031688093 7:124757152-124757174 CTAAGAAAGAAGATGGACAAGGG - Intronic
1032704794 7:134412539-134412561 CTTCCAATGAAGATAGAAAAAGG + Intergenic
1033799424 7:144882459-144882481 CTTTAAATGTACATGGACAATGG - Intergenic
1036298628 8:7555535-7555557 CTTGCAATTCAGATGGAGGAAGG + Intergenic
1036299933 8:7563185-7563207 CTTGCAATTCAGATGGAGGAAGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1041120105 8:54577803-54577825 TTAACAATGCAGTTGAACAATGG - Intergenic
1042935650 8:74055335-74055357 CTTCAAATGCAGAGGGACAGAGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1046136359 8:110032550-110032572 ATTTCAAGGGAGATGGACAAAGG + Intergenic
1048944569 8:139432421-139432443 TTCACAGGGCAGATGGACAAAGG - Intergenic
1051813925 9:21082068-21082090 CTTACAATGCAGATACACACTGG - Intergenic
1052490325 9:29158860-29158882 CTTAGAATTCAGAGGGATAAGGG - Intergenic
1055018927 9:71648460-71648482 TTTGCAATGCAGATGGAAAAAGG + Intergenic
1056193452 9:84206829-84206851 TTTACAAAGCTGATTGACAATGG - Intergenic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1058350654 9:104017769-104017791 CTTACAATGCAGGTGGAGCATGG + Intergenic
1188392304 X:29635879-29635901 CCTACAATGAGGATGGAGAAAGG - Intronic
1190271514 X:48867474-48867496 CTTACAATGAAAATGAAGAAAGG - Intergenic
1190930708 X:54947755-54947777 CCTACAGTGCAGGTGAACAATGG + Intronic
1194474302 X:94339015-94339037 CATACAATGCACAGGTACAAAGG - Intergenic
1195950376 X:110265652-110265674 CTTACAATGGGGATGGTCTATGG + Intronic
1198997321 X:142588548-142588570 ATTACAATCCAGGTGGTCAAGGG - Intergenic