ID: 964502010

View in Genome Browser
Species Human (GRCh38)
Location 3:157358312-157358334
Sequence CTAGTAAGTGCCCTTCTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 607
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 585}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964502006_964502010 14 Left 964502006 3:157358275-157358297 CCAAAGCACCAAGAAAAGTTTGC 0: 1
1: 0
2: 0
3: 17
4: 199
Right 964502010 3:157358312-157358334 CTAGTAAGTGCCCTTCTAACAGG 0: 1
1: 0
2: 0
3: 21
4: 585
964502007_964502010 6 Left 964502007 3:157358283-157358305 CCAAGAAAAGTTTGCTAGAAAAG 0: 1
1: 0
2: 2
3: 25
4: 310
Right 964502010 3:157358312-157358334 CTAGTAAGTGCCCTTCTAACAGG 0: 1
1: 0
2: 0
3: 21
4: 585
964502004_964502010 26 Left 964502004 3:157358263-157358285 CCAAGAAAAGTCCCAAAGCACCA 0: 1
1: 0
2: 0
3: 17
4: 227
Right 964502010 3:157358312-157358334 CTAGTAAGTGCCCTTCTAACAGG 0: 1
1: 0
2: 0
3: 21
4: 585
964502005_964502010 15 Left 964502005 3:157358274-157358296 CCCAAAGCACCAAGAAAAGTTTG 0: 1
1: 0
2: 2
3: 20
4: 285
Right 964502010 3:157358312-157358334 CTAGTAAGTGCCCTTCTAACAGG 0: 1
1: 0
2: 0
3: 21
4: 585

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964502010 Original CRISPR CTAGTAAGTGCCCTTCTAAC AGG Intronic
901949552 1:12731292-12731314 TTAATAATTGCCATTCTAACTGG + Intergenic
904246723 1:29193442-29193464 CATGGAACTGCCCTTCTAACTGG - Intronic
906179338 1:43804909-43804931 CTAGTAAGTGCCCTGAGACCTGG - Intronic
907533668 1:55127745-55127767 TTAATAATTGCCATTCTAACTGG + Intronic
908071081 1:60460882-60460904 TTATTAAGAGCCATTCTAACTGG - Intergenic
908102225 1:60803340-60803362 TTAGTAATAGCCATTCTAACTGG + Intergenic
908664841 1:66478459-66478481 TTAGTAATAGCCATTCTAACTGG - Intergenic
908681398 1:66665648-66665670 TTAGTGATTGCCATTCTAACTGG + Intronic
908914330 1:69108506-69108528 TTAGTGATTGCCATTCTAACTGG - Intergenic
909060726 1:70876117-70876139 TTAGTAAGAGCCATTCTGACTGG + Intronic
909218066 1:72917411-72917433 TTAGTAATAGCCATTCTAACAGG + Intergenic
909343485 1:74557883-74557905 TTAATAATTGCCATTCTAACTGG - Intergenic
910274100 1:85429692-85429714 TTAGTGATTGCCATTCTAACTGG + Intronic
910528866 1:88212794-88212816 TTAATGATTGCCCTTCTAACTGG - Intergenic
910614667 1:89184158-89184180 CTAGTAACAGCCATTCTGACTGG - Exonic
911353143 1:96780654-96780676 CTTGTAACTCCCCTTCTACCTGG + Intronic
911386892 1:97187257-97187279 TTAGTAAGAGCCATTCTGACTGG + Intronic
911979592 1:104550522-104550544 TTAGTAATTGCCATTCTGACTGG - Intergenic
911991173 1:104698589-104698611 TTAATAATTGCCATTCTAACTGG - Intergenic
912857690 1:113185890-113185912 CTAATAATAGCCATTCTAACTGG - Intergenic
913027815 1:114863611-114863633 TTAATAATTGCCATTCTAACTGG + Intronic
915181966 1:154069511-154069533 TTAGTGATTGCCATTCTAACTGG - Intronic
915677910 1:157548748-157548770 TTAATAATTGCCATTCTAACTGG - Intronic
915829780 1:159116146-159116168 TTAGTGATTGCCATTCTAACAGG - Intronic
915877217 1:159624172-159624194 CTAATGATTGCCATTCTAACTGG - Intergenic
916593401 1:166216526-166216548 TTAGTAACAGCCATTCTAACTGG + Intergenic
917053498 1:170952063-170952085 TTAATGAGTGCCATTCTAACTGG - Intronic
917161425 1:172061161-172061183 TTAATGATTGCCCTTCTAACTGG - Intronic
917694715 1:177510390-177510412 TTAATAATTGCCATTCTAACTGG - Intergenic
918137710 1:181689655-181689677 TTAATAATTGCCATTCTAACTGG + Intronic
919146310 1:193640095-193640117 CTAATGATTGCCATTCTAACTGG + Intergenic
919150359 1:193689481-193689503 TTAGTAACTGCCATTATAACTGG - Intergenic
919396247 1:197052235-197052257 TTAGTAATTGCCATTCTGACTGG - Intronic
919721103 1:200836769-200836791 TTAGTAAGAGCCATTCTAACCGG + Intronic
920625514 1:207593916-207593938 TTAGTGATTGCCATTCTAACTGG - Intronic
922377955 1:224988435-224988457 CTAATAATCGCCATTCTAACTGG - Intronic
922569230 1:226623711-226623733 CTAGTAAGGACCCTTGTATCTGG - Intergenic
923188051 1:231593433-231593455 CTAATGACTGCCATTCTAACTGG - Intronic
924017260 1:239740779-239740801 TTAATAATCGCCCTTCTAACTGG - Intronic
1063729914 10:8684866-8684888 CTAATGATTGCCATTCTAACTGG + Intergenic
1064157148 10:12912303-12912325 TTGGTAATAGCCCTTCTAACGGG + Intronic
1064599595 10:16980155-16980177 TTAATAATTGCCATTCTAACTGG - Intronic
1065170409 10:23021497-23021519 TTAGTAATAGCCATTCTAACTGG + Intronic
1065652404 10:27906324-27906346 TTAGTGATTGCCATTCTAACTGG - Intronic
1066072535 10:31834357-31834379 CTAATTAGTGCCCTTATAAAAGG + Intronic
1066131660 10:32400280-32400302 TTAATAATTGCCATTCTAACTGG + Intergenic
1066583636 10:36908141-36908163 TTAATAATTGCCATTCTAACTGG + Intergenic
1066786665 10:39011874-39011896 TTAATGATTGCCCTTCTAACTGG - Intergenic
1068053124 10:51977647-51977669 TTAATAATTGCCATTCTAACTGG + Intronic
1068407649 10:56612074-56612096 TTAGTAATCGCCATTCTAACTGG - Intergenic
1068420122 10:56780223-56780245 CTAATAATCGCCATTCTAACCGG + Intergenic
1070516380 10:77211909-77211931 TTAGTAATAGCCATTCTAACTGG - Intronic
1072357864 10:94629432-94629454 TTAGTAACTGCCATTCTGACTGG + Intergenic
1073784243 10:106871163-106871185 TTAGTAATAGCCATTCTAACTGG - Intronic
1073822701 10:107283262-107283284 TTAGTGATTGCCATTCTAACTGG - Intergenic
1074190886 10:111135935-111135957 ATATTAATTGCCATTCTAACAGG - Intergenic
1074845657 10:117395032-117395054 TTAGTAATTGCCATTCTGACGGG - Intergenic
1077657612 11:4036533-4036555 TTAGTAATTGCCATTCTGACTGG + Intronic
1077775144 11:5262687-5262709 TTAATAATTGCCATTCTAACTGG - Intronic
1078982063 11:16547075-16547097 TTAGTAATAGCCATTCTAACTGG - Intronic
1078998852 11:16733040-16733062 TTAATGATTGCCCTTCTAACTGG - Intronic
1079463046 11:20701186-20701208 TTAATAATTGCCATTCTAACTGG + Intronic
1080235038 11:30058527-30058549 TTAATAATTGCCATTCTAACTGG - Intergenic
1080817698 11:35774149-35774171 TTAATAATTGCCATTCTAACTGG + Intronic
1081035071 11:38134055-38134077 TTAGTGATTGCCATTCTAACTGG - Intergenic
1082227973 11:49730619-49730641 CTAATGATTGCCATTCTAACTGG - Intergenic
1082633532 11:55568205-55568227 CTAATGATTGCCATTCTAACTGG + Intergenic
1082886452 11:58088499-58088521 TTAATAATTGCCATTCTAACTGG + Intronic
1083370717 11:62177505-62177527 CTTGTAATAGCCATTCTAACAGG + Intergenic
1083505393 11:63152181-63152203 CTAATGATTGCCATTCTAACTGG + Intronic
1084995856 11:72977638-72977660 TTAGTGATTGCCATTCTAACTGG - Intronic
1085557711 11:77440416-77440438 ATAGTAAGTGCCCTTATAGTAGG - Intronic
1085979035 11:81699489-81699511 CTAATAAAAGCCATTCTAACTGG - Intergenic
1086314659 11:85578694-85578716 GTAGTAATTGCCATTCTAACTGG - Intronic
1086423070 11:86656931-86656953 CTAATGATTGCCATTCTAACTGG - Intronic
1086740361 11:90360525-90360547 ATAGTAATAGCCCTTCTGACTGG + Intergenic
1087699225 11:101416797-101416819 TTAGTAATAGCCATTCTAACTGG + Intergenic
1088370677 11:109085071-109085093 TTAGTGATTGCCATTCTAACTGG + Intergenic
1088489981 11:110377624-110377646 CAACTAAGTGCCCTTTTAAAAGG - Intergenic
1090160516 11:124488818-124488840 TTAGTGATTGCCATTCTAACTGG - Intergenic
1090321592 11:125849307-125849329 TTAGTAATTGCCATTCTGACTGG - Intergenic
1090739993 11:129650579-129650601 TTAATGATTGCCCTTCTAACTGG + Intergenic
1090752130 11:129756232-129756254 TTAATGATTGCCCTTCTAACTGG - Intergenic
1090998296 11:131886515-131886537 CTAAAAAGATCCCTTCTAACTGG + Intronic
1092694135 12:11150133-11150155 TTAGTGATTGCCATTCTAACTGG - Intronic
1093064053 12:14638179-14638201 TTAGTAATAGCCATTCTAACTGG - Intronic
1093178785 12:15944406-15944428 TTAATGATTGCCCTTCTAACTGG + Intronic
1093504230 12:19845996-19846018 TTAATAATTGCCATTCTAACTGG + Intergenic
1093571107 12:20666953-20666975 TTAGTAATAGCCATTCTAACTGG + Intronic
1093660414 12:21750335-21750357 CTAATGATTGCCATTCTAACAGG - Intronic
1093802846 12:23394439-23394461 CTAATGATTGCCATTCTAACAGG - Intergenic
1093839282 12:23876440-23876462 TTAGTGATTGCCATTCTAACTGG - Intronic
1094873051 12:34609184-34609206 CTAATGATTGCCATTCTAACTGG + Intergenic
1095069556 12:37824051-37824073 TTAGTGATTGCCATTCTAACTGG + Intergenic
1095072325 12:37868414-37868436 TTAGTGATTGCCATTCTAACTGG - Intergenic
1095090315 12:38098573-38098595 TTAATAATTGCCATTCTAACTGG - Intergenic
1095210513 12:39488772-39488794 TTAATAATTGCCATTCTAACTGG - Intergenic
1095229871 12:39726841-39726863 TTAATAATTGCCATTCTAACTGG + Intronic
1095232072 12:39751365-39751387 TTACTAATTGCCATTCTAACTGG - Intronic
1095323432 12:40858458-40858480 TTAGTAATTGCCCTTCTGACTGG - Intronic
1095341422 12:41093476-41093498 TTAGTGACTGCCATTCTAACTGG + Intergenic
1095346741 12:41158884-41158906 TTAGTGATTGCCATTCTAACTGG + Intergenic
1095610604 12:44123088-44123110 TTAGTAATAGCCATTCTAACTGG + Intronic
1095647291 12:44562630-44562652 TTAGTGATTGCCATTCTAACTGG - Intronic
1096883589 12:54694380-54694402 TTAATAATTGCCGTTCTAACTGG - Intergenic
1096894494 12:54807302-54807324 TTAATAATTGCCATTCTAACTGG + Intergenic
1097227155 12:57484377-57484399 CTAGTTAGGGCCCCTCTAATGGG - Intronic
1097371558 12:58788026-58788048 CTAGTAATAGCCTTTCTGACTGG - Intronic
1097598041 12:61658699-61658721 CTAATAATTGCCATTCTGACTGG + Intergenic
1097719561 12:63005220-63005242 TTAGTGATTGCCATTCTAACTGG - Intergenic
1098436632 12:70475177-70475199 TTAGTGATTGCCATTCTAACTGG - Intergenic
1098564051 12:71911086-71911108 TTAGTGATTGCCATTCTAACTGG - Intronic
1098906138 12:76164384-76164406 TTAATAATTGCCATTCTAACTGG + Intergenic
1099000581 12:77174064-77174086 TTAGTGATTGCCATTCTAACTGG + Intergenic
1099022520 12:77424146-77424168 TTAGTGATTGCCATTCTAACTGG + Intergenic
1099275470 12:80570260-80570282 TTAATAATTGCCATTCTAACTGG + Intronic
1099312767 12:81048545-81048567 CTAATGATTGCCATTCTAACTGG + Intronic
1099344587 12:81482201-81482223 TTAATAATTGCCATTCTAACTGG - Intronic
1099409787 12:82311167-82311189 CTAATGATTGCCATTCTAACTGG + Intronic
1099696071 12:86021051-86021073 TTAATGAGTGCCATTCTAACTGG - Intronic
1099774250 12:87103739-87103761 TTAATAATTGCCATTCTAACTGG - Intergenic
1100132889 12:91518373-91518395 TTAGTAATTGCCATTCTGACTGG - Intergenic
1100264844 12:92965816-92965838 TTAATAATTGCCATTCTAACTGG + Intergenic
1100466648 12:94851840-94851862 TTAGTAATAGCCATTCTAACTGG - Intergenic
1101069347 12:101057541-101057563 TTAGTGATTGCCATTCTAACTGG + Intronic
1101291076 12:103370193-103370215 TTAGTAATAGCCATTCTAACTGG - Intronic
1101494917 12:105244786-105244808 TTAATAATTGCCATTCTAACTGG + Intronic
1101528213 12:105550845-105550867 CCAGTTAGTGGCCTTCTAACTGG + Intergenic
1102906556 12:116680381-116680403 TTAGTAATAGCCATTCTAACAGG + Intergenic
1103032070 12:117623907-117623929 CTAATGACTGCCATTCTAACTGG + Intronic
1104133600 12:125917357-125917379 TTAGTGAGTGCCCTTCAAAAGGG + Intergenic
1106363600 13:29055734-29055756 TTAGTAATTGCCATTCTAACTGG + Intronic
1107970357 13:45635845-45635867 TTAGTAATTGCCATTCTAACTGG + Intergenic
1108074320 13:46663651-46663673 CTAGTAAGTTTCCTTTTCACAGG - Intronic
1108163764 13:47670260-47670282 TTAGTGATTGCCATTCTAACTGG - Intergenic
1108335716 13:49439761-49439783 TTAGTAAGAGCCATTCTGACTGG + Intronic
1108480162 13:50861365-50861387 TTAGTAATTGCCATTCTAACAGG - Intergenic
1108917576 13:55634631-55634653 TTAATAATTGCCATTCTAACTGG + Intergenic
1109236320 13:59825713-59825735 TTAATAATTGCCATTCTAACTGG + Intronic
1109427038 13:62178717-62178739 TTAATAATTGCCATTCTAACTGG - Intergenic
1109471444 13:62810862-62810884 TTAGTAATTGCCATTCTGACTGG + Intergenic
1109847789 13:68019646-68019668 TTCCTGAGTGCCCTTCTAACAGG - Intergenic
1110486457 13:76050496-76050518 CGAGTTAGTGCCCTTATAAAAGG - Intergenic
1110750315 13:79107159-79107181 TTAGTAATTGTCATTCTAACTGG - Intergenic
1110752817 13:79135833-79135855 TTAATGATTGCCCTTCTAACTGG - Intergenic
1110944223 13:81392519-81392541 TTAGTAATAGCCATTCTAACTGG + Intergenic
1111428440 13:88120748-88120770 TTAGTAATAGCCATTCTAACTGG + Intergenic
1111481554 13:88833732-88833754 TTAGTGATTGCCATTCTAACTGG - Intergenic
1112178223 13:97049859-97049881 CTAATGATTGCCATTCTAACTGG + Intergenic
1112876090 13:104040439-104040461 TTAGTAACTGCCATTCTGACTGG + Intergenic
1113005828 13:105700755-105700777 TTAATAATTGCCATTCTAACTGG + Intergenic
1114433470 14:22683267-22683289 TTAGTGATTGCCATTCTAACTGG - Intergenic
1114785375 14:25591198-25591220 TTAATAATTGCCATTCTAACTGG + Intergenic
1114910831 14:27193496-27193518 TTAGTGATTGCCGTTCTAACTGG + Intergenic
1114943590 14:27649428-27649450 TTAATAATTGCCATTCTAACTGG - Intergenic
1115344297 14:32326041-32326063 TTAATAATTGCCATTCTAACTGG - Intergenic
1115815752 14:37162604-37162626 TTAATGATTGCCCTTCTAACTGG - Intronic
1116604410 14:46971005-46971027 TTAGTAATAGCCATTCTAACTGG - Intronic
1116641983 14:47475287-47475309 TTAATAATTGCCATTCTAACTGG - Intronic
1117630075 14:57681958-57681980 TTAGTGATTGCCATTCTAACTGG - Intronic
1117636546 14:57750556-57750578 GTAGTAATAGCCATTCTAACTGG + Intronic
1117857060 14:60045948-60045970 TTAGTAATTGCCATTCTAACTGG + Intronic
1117891705 14:60428943-60428965 TTAGTAATAGCCATTCTAACTGG + Intronic
1118635496 14:67745091-67745113 TTAATAATTGCCATTCTAACTGG + Intronic
1118961017 14:70533063-70533085 TTAATAATTGCCATTCTAACTGG - Intronic
1119369325 14:74125292-74125314 TTAGTGATTGCCATTCTAACTGG + Intronic
1120065674 14:80038397-80038419 TTAGTAATACCCCTTCTAACAGG - Intergenic
1120070176 14:80093982-80094004 CTAATGATTGCCATTCTAACTGG - Intergenic
1120284583 14:82482792-82482814 TTAGTGATTGCCATTCTAACTGG + Intergenic
1120752717 14:88212819-88212841 ATACAAAGTGCACTTCTAACAGG + Intronic
1121678639 14:95774776-95774798 GTAGTGAGTGCTCTTCTAAGTGG + Intergenic
1124385317 15:29203474-29203496 TTAATAATTGCCATTCTAACTGG + Intronic
1125984612 15:44037977-44037999 TTAGTGATTGCCATTCTAACTGG + Intronic
1126128562 15:45318623-45318645 TTAGTGATTGCCATTCTAACTGG - Intergenic
1126254766 15:46613328-46613350 TTAGTGATTGCCATTCTAACTGG + Intergenic
1127011859 15:54639963-54639985 TTGGTAATTGCCATTCTAACAGG - Intergenic
1127236030 15:57053146-57053168 TTAATAATTGCCATTCTAACAGG + Intronic
1128858754 15:71046380-71046402 TTAGTAATAGCCATTCTAACTGG + Intronic
1129965050 15:79727249-79727271 TTAGTAATAGCCATTCTAACCGG + Intergenic
1130800472 15:87257438-87257460 TTAATAATTGCCATTCTAACTGG + Intergenic
1131083720 15:89557869-89557891 TTAGTGATTGCCATTCTAACTGG + Intergenic
1131331706 15:91505949-91505971 TTAATAATTGCCATTCTAACTGG - Intergenic
1131634679 15:94219093-94219115 TTAATAATTGCCATTCTAACTGG - Intergenic
1134300603 16:12987287-12987309 TTAGTAATTGCCATTCTGACAGG + Intronic
1134433137 16:14230596-14230618 TTAATAATTGCCATTCTAACTGG - Intronic
1135249958 16:20892454-20892476 CTAGTAAGTGCTCTTTAAACAGG - Intronic
1137693175 16:50443643-50443665 TTAATAATTGCCATTCTAACAGG - Intergenic
1137939699 16:52671900-52671922 TTAGTAATAGCCGTTCTAACTGG + Intergenic
1137967133 16:52946778-52946800 TTAATAATCGCCCTTCTAACTGG + Intergenic
1138720876 16:59077705-59077727 CTAATGATTGCCATTCTAACTGG - Intergenic
1138752966 16:59446279-59446301 CTAATAATTGCCATTCTGACTGG + Intergenic
1138843171 16:60533980-60534002 TTAATAATTGCCATTCTAACGGG + Intergenic
1138919303 16:61507789-61507811 TTAGTAATAGCCATTCTAACTGG - Intergenic
1139698045 16:68689235-68689257 TTAGTAAGTGCCCATTTAGCCGG + Intronic
1140292070 16:73668865-73668887 TTAATAATTGCCATTCTAACTGG - Intergenic
1140779577 16:78282377-78282399 CTAGTAAGAGACCATCCAACAGG - Intronic
1142936213 17:3334068-3334090 TTAGTAATTGCCATTCTGACTGG - Intergenic
1143876302 17:9993282-9993304 CTAATGATTGCCATTCTAACTGG + Intronic
1144012979 17:11167912-11167934 TTAATAATTGCCATTCTAACTGG - Intergenic
1144362309 17:14507220-14507242 ATAGTATGTGCCCTCCTATCTGG - Intergenic
1149172889 17:53834095-53834117 TTAGTAATTGCCTTTCTGACTGG + Intergenic
1149241695 17:54658216-54658238 TTAGTAATTGCCATTCTGACTGG + Intergenic
1149409507 17:56390724-56390746 TTAATAATTGCCATTCTAACTGG + Intronic
1149643632 17:58222002-58222024 TTAGTAATTGCCATTCTGACTGG + Intronic
1150453085 17:65285576-65285598 GTAGTAATTGCCATTCTGACTGG + Intergenic
1150546324 17:66161146-66161168 TTAGTGATTGCCATTCTAACTGG - Intronic
1151981891 17:77516885-77516907 TTAGTAACAGCCATTCTAACTGG + Intergenic
1153351914 18:4090557-4090579 TTAATAATTGCCATTCTAACTGG - Intronic
1155550375 18:26958784-26958806 TTAGTAATAGCCATTCTAACTGG - Intronic
1156344919 18:36248130-36248152 CTGGTAATAGCCATTCTAACTGG + Intronic
1158015623 18:52779831-52779853 TTAATAATTGCCATTCTAACTGG + Intronic
1158047733 18:53176642-53176664 TTAGTGATTGCCATTCTAACTGG - Intronic
1158176661 18:54664880-54664902 TTAATAATTGCCATTCTAACTGG + Intergenic
1158330284 18:56354877-56354899 TTAATAATTGCCCTTCTGACTGG + Intergenic
1159598760 18:70408845-70408867 CAAGTAATGGCCCTTCTTACAGG + Intergenic
1160484047 18:79271916-79271938 CTAATGATTGCCATTCTAACTGG + Intronic
1160485221 18:79285298-79285320 CTAATGATTGCCATTCTAACTGG + Intronic
1161526970 19:4762130-4762152 CTGGTGACTGCCCTTCTAAGAGG - Intergenic
1163206223 19:15804899-15804921 TTAGTGATTGCCATTCTAACTGG + Intergenic
1164046535 19:21547562-21547584 TTAATAATTGCCATTCTAACTGG + Intronic
1164277367 19:23732114-23732136 TTAATAAGAGCCATTCTAACTGG + Intergenic
925453641 2:3994172-3994194 TTAATAATTGCCATTCTAACTGG + Intergenic
925518257 2:4709144-4709166 TTTCTAAGTGCCATTCTAACAGG - Intergenic
926471978 2:13271826-13271848 TTAATAATTGCCATTCTAACTGG + Intergenic
926851720 2:17205263-17205285 TTAGTGATTGCCATTCTAACTGG + Intergenic
927401269 2:22714392-22714414 TTAATAAGAGCCATTCTAACTGG - Intergenic
928249375 2:29661314-29661336 CTAGTTAGGGGCTTTCTAACAGG + Intronic
930281585 2:49376123-49376145 TTAGTGATTGCCATTCTAACTGG - Intergenic
930437533 2:51364232-51364254 TTAATAATCGCCCTTCTAACTGG - Intergenic
930458735 2:51641835-51641857 TTAGTGATTGCCATTCTAACTGG + Intergenic
930936498 2:56958924-56958946 TTAATAATTGCCATTCTAACTGG + Intergenic
930988081 2:57614151-57614173 TTAGTGATTGCCATTCTAACTGG - Intergenic
931037952 2:58264398-58264420 TTAGTGATTGCCATTCTAACTGG - Intergenic
931215250 2:60236006-60236028 CTAATGATTGCCATTCTAACTGG + Intergenic
932508976 2:72265931-72265953 TTAATAATTGCCATTCTAACTGG + Intronic
933398546 2:81762640-81762662 TTAGTGATTGCCATTCTAACTGG + Intergenic
934012928 2:87843525-87843547 TTAGTGATTGCCATTCTAACTGG - Intergenic
935187858 2:100750692-100750714 CTAGTCCATGCCCTGCTAACTGG - Intergenic
935236965 2:101147529-101147551 CAAGTAATAGCCATTCTAACTGG + Intronic
935479964 2:103574661-103574683 CTAATAATTGCCCTTCTGACTGG + Intergenic
935884699 2:107603964-107603986 TTAATAATTGCCATTCTAACTGG - Intergenic
935961032 2:108425655-108425677 CTAATAATTGCCATTCTGACTGG - Intergenic
936482681 2:112899599-112899621 TTAGTGATTGCCATTCTAACTGG + Intergenic
936495022 2:113011665-113011687 CTGGTAATAGCCATTCTAACAGG - Intergenic
936892121 2:117383869-117383891 TTAGTAATAGCCATTCTAACTGG + Intergenic
937724846 2:125150259-125150281 TTAGTGATTGCCCTTCTAACTGG + Intergenic
939066077 2:137484698-137484720 TTAATGATTGCCCTTCTAACTGG + Intronic
939461357 2:142499656-142499678 TTAATAATTGCCATTCTAACTGG + Intergenic
939731304 2:145787792-145787814 TTAGTGATTGCCATTCTAACTGG - Intergenic
939938243 2:148318133-148318155 TTAGTAATAGCCCTTCTGACTGG + Intronic
939941326 2:148354792-148354814 TTAATAATTGCCATTCTAACTGG + Intronic
939942565 2:148367791-148367813 TTAATAATTGCCATTCTAACTGG - Intronic
940603138 2:155885979-155886001 TTAATGAGTGCCATTCTAACTGG - Intergenic
940615537 2:156044560-156044582 CAAATAATTGCCATTCTAACTGG + Intergenic
940720131 2:157273052-157273074 TTAATAACTGCCATTCTAACTGG + Intronic
941228510 2:162879384-162879406 TTAATAATTGCCATTCTAACTGG - Intergenic
941845802 2:170131373-170131395 TTAGTGATTGCCATTCTAACTGG - Intergenic
942118354 2:172750664-172750686 CTGGTAATAGCCATTCTAACAGG + Intronic
942130462 2:172874011-172874033 CTAATGATTGCCATTCTAACTGG - Intronic
943028907 2:182663144-182663166 TTAGTAATAGCCATTCTAACTGG - Intergenic
943181081 2:184542304-184542326 TTAATAATTGCCATTCTAACTGG - Intergenic
943538803 2:189185402-189185424 GTAGTAAGAGTACTTCTAACTGG - Intergenic
943885411 2:193210572-193210594 TTAATAATTGCCATTCTAACTGG + Intergenic
943980668 2:194545769-194545791 TTAATAATTGCCATTCTAACTGG - Intergenic
944203023 2:197128319-197128341 CTAATAACTGCCATTCTGACTGG + Intronic
944259587 2:197661817-197661839 GTAGTAACAGCCATTCTAACTGG + Intronic
944281746 2:197905747-197905769 CTAATAATCGCCATTCTAACTGG + Intronic
944308192 2:198201723-198201745 TTAGTGATTGCCATTCTAACTGG - Intronic
944355647 2:198784500-198784522 TTAATAATTGCCATTCTAACTGG + Intergenic
945355707 2:208837025-208837047 TTAGTGATTGCCATTCTAACTGG - Intronic
945780202 2:214161480-214161502 TTAATAATTGCCATTCTAACTGG + Intronic
945789606 2:214288608-214288630 TTAGTAAGAGCCATTTTAACTGG + Intronic
946082755 2:217138373-217138395 TTAGTAATTGCCATTCTGACTGG + Intergenic
947283416 2:228481867-228481889 TTAATAATTGCCATTCTAACTGG + Intergenic
948086452 2:235253967-235253989 TTAGTAATTGCCATTCTGACTGG + Intergenic
1169562442 20:6816734-6816756 TTAATAATTGCCATTCTAACTGG - Intergenic
1170295663 20:14822108-14822130 CTAGAAAATGCACTTCTAAAAGG - Intronic
1171231137 20:23486444-23486466 TTAGTAATAGCCATTCTAACTGG + Intergenic
1172152136 20:32798101-32798123 CTATTAAGAGCACTTCTAGCTGG - Intronic
1174687943 20:52473455-52473477 ATAGTAAGTGCCCTTCAGAAGGG + Intergenic
1174928550 20:54787828-54787850 TTAATAATTGCCATTCTAACTGG - Intergenic
1175464512 20:59181052-59181074 TTAATAATTGCCATTCTAACTGG + Intergenic
1177008052 21:15698438-15698460 TTAGTGATTGCCATTCTAACTGG - Intergenic
1177239461 21:18437789-18437811 TTAGTGATTGCCATTCTAACTGG - Intronic
1178033994 21:28560427-28560449 CTAATAATTGCCGTTCTGACTGG - Intergenic
1179432314 21:41331116-41331138 TTAGTAATAGCCATTCTAACAGG + Intronic
1181338620 22:22161057-22161079 TTAGTGATTGCCATTCTAACTGG - Intergenic
1181361041 22:22336214-22336236 TTAATAATTGCCATTCTAACTGG - Intergenic
1181435416 22:22907477-22907499 CTAGTAAATGGTCTCCTAACTGG - Intergenic
1182920507 22:34074972-34074994 ATAGTAAGGGCTCTACTAACAGG - Intergenic
1182992180 22:34778387-34778409 TTAGTAATTGCCATTCTGACTGG - Intergenic
1185240744 22:49743976-49743998 TTATTAATTGCCATTCTAACTGG - Intergenic
949457884 3:4258576-4258598 TTAGTGATTGCCATTCTAACTGG - Intronic
949720315 3:6981758-6981780 CTAATAATAGCCCTTCTGACTGG - Intronic
951070754 3:18326419-18326441 TTAATAATTGCCATTCTAACTGG + Intronic
951498287 3:23354692-23354714 TTAGTGATTGCCATTCTAACTGG - Intronic
951912973 3:27770495-27770517 TTAATAATTGCCATTCTAACTGG + Intergenic
952030052 3:29131128-29131150 TTAATAATTGCCATTCTAACTGG - Intergenic
952067729 3:29592471-29592493 TTAATAATTGCCATTCTAACTGG - Intronic
952078429 3:29727670-29727692 TTAATAACTGCCATTCTAACTGG - Intronic
952724391 3:36568018-36568040 TTAATAATTGCCATTCTAACTGG + Intergenic
953053439 3:39367320-39367342 TTAGTGATTGCCATTCTAACTGG + Intergenic
953354479 3:42243950-42243972 TTAATGATTGCCCTTCTAACTGG - Intergenic
953418641 3:42737591-42737613 TTAATGATTGCCCTTCTAACTGG + Intronic
953934241 3:47026268-47026290 TTAGTGATTGCCATTCTAACTGG - Intronic
954490115 3:50896177-50896199 CTAATGATTGCCATTCTAACTGG + Intronic
954947187 3:54436241-54436263 TTAATAAATGCCATTCTAACTGG - Intronic
955642484 3:61100737-61100759 TTAATAATTGCCATTCTAACTGG + Intronic
956356193 3:68395254-68395276 TTAATAATTGCCATTCTAACTGG - Intronic
956476926 3:69632046-69632068 TTAATGATTGCCCTTCTAACTGG + Intergenic
957534751 3:81487222-81487244 TTAATGATTGCCCTTCTAACTGG + Intergenic
957626538 3:82659672-82659694 TTAATAATTGCCGTTCTAACTGG + Intergenic
957850215 3:85797937-85797959 TTAATGAGTGCCATTCTAACAGG + Intronic
957978864 3:87482118-87482140 TTAGTGATTGCCATTCTAACTGG - Intergenic
958011184 3:87882173-87882195 TTAGTGATTGCCATTCTAACTGG - Intergenic
958518992 3:95159402-95159424 TTAATAATTGCCATTCTAACTGG + Intergenic
958747245 3:98152113-98152135 CTAATGATTGCCATTCTAACTGG - Intergenic
959165287 3:102769197-102769219 TTAGTAATTGCCATTCTGACTGG + Intergenic
959469397 3:106731251-106731273 CTAGTATCTGCCCTTCTATATGG + Intergenic
960065864 3:113372042-113372064 TTAATGAGTGCCATTCTAACTGG - Intronic
963414115 3:144972563-144972585 TTAATAATTGCCATTCTAACTGG + Intergenic
963415671 3:144992813-144992835 TTAGTAATTGCCATTCTGACTGG + Intergenic
964053686 3:152425666-152425688 CTAATGATTGCCATTCTAACTGG - Intronic
964319020 3:155474390-155474412 CTAATGATTGCCATTCTAACTGG - Intronic
964399031 3:156279644-156279666 CTAATGATTGCCATTCTAACTGG + Intronic
964502010 3:157358312-157358334 CTAGTAAGTGCCCTTCTAACAGG + Intronic
964695783 3:159506147-159506169 TTAGTGATTGCCATTCTAACTGG + Intronic
964738330 3:159939636-159939658 CCAGGAACTGGCCTTCTAACTGG - Intergenic
965332215 3:167389656-167389678 TTAATAATTGCCATTCTAACTGG + Intergenic
965888372 3:173477866-173477888 CTAATAATTGCCATTCTGACTGG - Intronic
966131060 3:176640323-176640345 TTAATAATTGCCATTCTAACTGG + Intergenic
966277043 3:178186077-178186099 TTAGTAAGCGCCATTCTGACTGG - Intergenic
966449633 3:180043145-180043167 TTAGTGATTGCCATTCTAACTGG - Intergenic
967239457 3:187423074-187423096 TTAATAATAGCCCTTCTAACTGG - Intergenic
967944235 3:194789903-194789925 ATAGTAATAGCCATTCTAACTGG + Intergenic
968561044 4:1282580-1282602 CTAATAAGAGCCCGTGTAACTGG - Intergenic
969068362 4:4509239-4509261 TTAGTAATCGCCATTCTAACTGG + Intronic
970383165 4:15528762-15528784 CTAACAAGTGCACATCTAACGGG - Intronic
971084412 4:23254806-23254828 ATAGTAATTGCCATCCTAACGGG + Intergenic
971493716 4:27241425-27241447 TTAATAATTGCCATTCTAACTGG - Intergenic
972000485 4:34025626-34025648 TTAGTTATTGCCATTCTAACTGG + Intergenic
972500263 4:39671162-39671184 CTAATGATTGCCATTCTAACTGG + Intergenic
972919456 4:43920175-43920197 TTAATAATTGCCATTCTAACTGG + Intergenic
973290883 4:48469202-48469224 TTAATAATTGCCATTCTAACTGG + Intergenic
973564052 4:52165892-52165914 CTAATGATTGCCATTCTAACTGG + Intergenic
973714730 4:53664463-53664485 TTAGTGATTGCCATTCTAACTGG + Intronic
973732707 4:53838807-53838829 TTAATAATTGCCATTCTAACTGG - Intronic
973743372 4:53939746-53939768 TTAATAACTGCCATTCTAACTGG - Intronic
973756517 4:54079728-54079750 TTAATAATTGCCATTCTAACAGG - Intronic
974748851 4:66110882-66110904 CAAATAATTGCCATTCTAACTGG - Intergenic
974760853 4:66271678-66271700 CTAATAATTGCCATTCTGACTGG - Intergenic
974771041 4:66414036-66414058 TTAATGATTGCCCTTCTAACTGG - Intergenic
975747371 4:77487669-77487691 TTAGTGATTGCCATTCTAACAGG + Intergenic
975894652 4:79074346-79074368 TTAGTAATTGCCATTCTGACTGG - Intergenic
976060845 4:81126554-81126576 TTAATGATTGCCCTTCTAACTGG + Intronic
976093277 4:81479406-81479428 TTAATAATTGCCATTCTAACTGG - Intronic
976142747 4:82009540-82009562 TTAATAATTGCCATTCTAACTGG - Intronic
976368935 4:84264875-84264897 TTAGTAATAGCCATTCTAACTGG - Intergenic
976490239 4:85662194-85662216 CTAATGATTGCCATTCTAACTGG + Intronic
976558048 4:86472277-86472299 CTAGTAAGAGCAATTCTAAGTGG + Intronic
976862064 4:89677403-89677425 TTAGTGATTGCCATTCTAACTGG - Intergenic
977060299 4:92250719-92250741 CTAATAATTGCCATTCTGACTGG + Intergenic
977740163 4:100470350-100470372 TTAGTAATAGCCATTCTAACTGG - Intronic
977752354 4:100624497-100624519 TTAGTGACTGCCATTCTAACTGG + Intronic
978015663 4:103742933-103742955 TTAATGAGTGCCATTCTAACTGG + Intergenic
978137973 4:105286465-105286487 TTAATAATTGCCATTCTAACTGG - Intergenic
978314638 4:107422157-107422179 TTAGTAATAGCCATTCTAACTGG - Intergenic
979152500 4:117337750-117337772 TTAGTAATAGCCATTCTAACTGG + Intergenic
979445443 4:120807163-120807185 TTAGTGATTGCCATTCTAACTGG - Intronic
979487952 4:121290235-121290257 CTAATGATTGCCATTCTAACTGG - Intergenic
980280727 4:130715828-130715850 CTAATGATTGCCATTCTAACTGG + Intergenic
980426092 4:132629821-132629843 TTAGTGATTGCCATTCTAACTGG - Intergenic
980508606 4:133756611-133756633 CTAGTAATTGCCATTCTGACTGG + Intergenic
980598950 4:134994078-134994100 TTAATAATTGCCATTCTAACTGG - Intergenic
981231512 4:142361970-142361992 CTAGAATGTGTCCTTCTTACTGG - Intronic
982379408 4:154733449-154733471 CTACTAAGTGACCTTTTAATTGG + Intronic
982517706 4:156372597-156372619 TTAGTGATTGCCATTCTAACTGG - Intergenic
982725069 4:158897519-158897541 TTAGTGATTGCCGTTCTAACTGG + Intronic
983402631 4:167284644-167284666 TTAATAATTGCCGTTCTAACTGG + Intergenic
983598249 4:169494775-169494797 TTAGTGATTGCCATTCTAACTGG + Intronic
983663509 4:170156235-170156257 TTAGTGATTGCCATTCTAACTGG + Intergenic
984143535 4:176033553-176033575 TTAATAATTGCCATTCTAACTGG - Intergenic
984182103 4:176496601-176496623 TTAATGATTGCCCTTCTAACTGG - Intergenic
984489492 4:180415018-180415040 CAAGTAAGTGTCATCCTAACTGG - Intergenic
984769665 4:183426471-183426493 TTAATAAGTGCCATTCTGACTGG + Intergenic
984854454 4:184182324-184182346 CTAGTAATCGCCGTTCTGACTGG - Intronic
987808863 5:22806653-22806675 CTAATGATTGCCATTCTAACTGG + Intronic
987902833 5:24035811-24035833 TTAATAATTGCCATTCTAACTGG + Intronic
988192369 5:27955723-27955745 CTAATGATTGCCATTCTAACTGG - Intergenic
988209026 5:28178532-28178554 TTAGTAACAGCCATTCTAACTGG - Intergenic
988665918 5:33327230-33327252 TTAGTAATTGCCATTCTGACTGG + Intergenic
989964679 5:50453664-50453686 GTAATAATTGCCATTCTAACTGG + Intergenic
990354031 5:54947988-54948010 CTAGTAATAGCCATTCTAACTGG - Intergenic
990720887 5:58694611-58694633 TTAGTGATTGCCATTCTAACTGG + Intronic
990870458 5:60425997-60426019 TTAATAATTGCCATTCTAACTGG - Intronic
991175025 5:63677658-63677680 TTAATAATTGCCATTCTAACTGG + Intergenic
991180791 5:63748393-63748415 TTAGTGATTGCCATTCTAACTGG - Intergenic
992254198 5:74905261-74905283 CTAATGATTGCCATTCTAACTGG + Intergenic
992659032 5:78939959-78939981 CTAATGATTGCCATTCTAACTGG + Intronic
992911566 5:81400712-81400734 TTAGTGAGTGCCCTTGTAACAGG + Intergenic
993543821 5:89186323-89186345 TTAATAATTGCCATTCTAACTGG - Intergenic
993826337 5:92691793-92691815 TTAATAATTGCCATTCTAACTGG - Intergenic
994235834 5:97361163-97361185 TTAATAATTGCCATTCTAACTGG - Intergenic
994601709 5:101913524-101913546 TTAGTGATTGCCATTCTAACTGG + Intergenic
994621322 5:102166414-102166436 CTAATGATTGCCATTCTAACTGG - Intergenic
994663097 5:102676554-102676576 TTAATGATTGCCCTTCTAACTGG - Intergenic
994838047 5:104882824-104882846 TTAGTGATTGCCATTCTAACTGG - Intergenic
994859630 5:105171861-105171883 CTAATAACTGCCATTCTGACTGG - Intergenic
995330345 5:110939430-110939452 TTAGTGATTGCCATTCTAACTGG - Intergenic
995416490 5:111919189-111919211 CTAATGATTGCCATTCTAACTGG - Intronic
995617483 5:113981836-113981858 TTAGTAATAGCCATTCTAACTGG + Intergenic
995943303 5:117611212-117611234 CTAGTAATAGCCATTCTGACTGG + Intergenic
996660647 5:125998411-125998433 TTAGTAATCGCCATTCTAACTGG - Intergenic
996868617 5:128159702-128159724 TTAATGATTGCCCTTCTAACTGG - Intronic
997181785 5:131836575-131836597 TTAATAATTGCCATTCTAACTGG + Intronic
997430445 5:133835488-133835510 ATAGTAAGTGCCCTGCTTCCTGG - Intergenic
997496547 5:134331974-134331996 CTAATGATTGCCATTCTAACTGG + Intronic
997620399 5:135286501-135286523 TTAGTAATAGCCATTCTAACAGG + Intronic
997799757 5:136848389-136848411 CTAATGATTGCCATTCTAACTGG + Intergenic
998755161 5:145369799-145369821 TTAATAATTGCCATTCTAACTGG + Intergenic
998916181 5:147014199-147014221 CTAATGATTGCCATTCTAACTGG - Intronic
999523998 5:152382583-152382605 CTAATAATTACCATTCTAACTGG + Intergenic
999558510 5:152773093-152773115 TTAATAACTGCCATTCTAACTGG - Intergenic
999659640 5:153847004-153847026 CTAATAACAGCCATTCTAACTGG + Intergenic
999707229 5:154284601-154284623 CTAGAAAGTGCTCTTCTTAGAGG - Intronic
1000389673 5:160710288-160710310 TTAATAATTGCCATTCTAACTGG + Intronic
1001111477 5:168900099-168900121 TTAGTAATAGCCATTCTAACTGG - Intronic
1001612431 5:173013836-173013858 TTAGTAATAGCCATTCTAACTGG - Intronic
1002247995 5:177901189-177901211 TTAGTAATAGCCATTCTAACTGG + Intergenic
1003673995 6:8186001-8186023 TTAGTAATTGCCATTCTGACGGG + Intergenic
1003759446 6:9160367-9160389 CTAATAATCGCCATTCTAACTGG - Intergenic
1005034581 6:21543919-21543941 TTAATAATTGCCATTCTAACTGG + Intergenic
1005955036 6:30657666-30657688 CAAGTAAGTGCACTCCTCACTGG + Intronic
1007296250 6:40823726-40823748 TTAGTGATTGCCATTCTAACTGG - Intergenic
1007844962 6:44746300-44746322 TTAATAATTGCCATTCTAACTGG + Intergenic
1008060594 6:46992687-46992709 TTAATAATTGCCATTCTAACTGG - Intergenic
1008095237 6:47333294-47333316 TTAATGATTGCCCTTCTAACTGG - Intergenic
1008398044 6:51032073-51032095 TTAGTGATTGCCATTCTAACTGG + Intergenic
1008825660 6:55689987-55690009 TTAGTGATTGCCATTCTAACTGG - Intergenic
1009302896 6:62049753-62049775 TTAATAATTGCCATTCTAACTGG - Intronic
1009599448 6:65779666-65779688 TTAGTGATTGCCATTCTAACTGG - Intergenic
1010304550 6:74303939-74303961 TTAATAATTGCCATTCTAACTGG - Intergenic
1010908391 6:81521409-81521431 TTAATGATTGCCCTTCTAACTGG + Intronic
1010948832 6:82010536-82010558 TTAGTAATTGCCATTCTAATTGG + Intergenic
1011062529 6:83287831-83287853 CTAATGATTGCCTTTCTAACTGG + Intronic
1011229673 6:85146279-85146301 TTAATGATTGCCCTTCTAACTGG + Intergenic
1011234484 6:85201097-85201119 TTAGTGACTGCCATTCTAACTGG + Intergenic
1011269670 6:85564449-85564471 TTAATAATTGCCATTCTAACTGG + Intronic
1011981158 6:93380473-93380495 TTAGTAAGTGGCATTCTCACTGG + Intronic
1012507363 6:99963058-99963080 CTAGTAATGGCCATACTAACAGG - Intronic
1012529918 6:100222837-100222859 TTAATAATTGCCATTCTAACTGG + Intergenic
1012711391 6:102610376-102610398 CTAATGATTGCCATTCTAACTGG + Intergenic
1012765798 6:103365315-103365337 TTAGTAATGGCCATTCTAACTGG - Intergenic
1013462052 6:110384235-110384257 TTAATAATTGCCATTCTAACTGG - Intergenic
1014422808 6:121266378-121266400 TTAATAATTGCCATTCTAACTGG - Intronic
1015212937 6:130718514-130718536 TTAATAAGTGCCATTCTGACTGG - Intergenic
1015331823 6:131988659-131988681 CTAATGATTGCCATTCTAACTGG + Intergenic
1015401550 6:132794021-132794043 CTAGGAAATGCCCTTCTCACTGG + Intronic
1015566706 6:134580342-134580364 TTAGTAATTGCCATTCTAACTGG - Intergenic
1015662640 6:135592440-135592462 TTAATAAGAGCCATTCTAACTGG + Intergenic
1016140062 6:140597362-140597384 TTAGTAATTGCCATTCTGACTGG + Intergenic
1016188892 6:141235637-141235659 TTAGTGATTGCCATTCTAACTGG - Intergenic
1016488788 6:144573074-144573096 TTAGTAATTGCCATTCTAACTGG + Intronic
1016729406 6:147412286-147412308 CTAGTAATAGCCAGTCTAACAGG - Intergenic
1016867902 6:148786892-148786914 TTAGTAATTGCCATTCTGACTGG + Intronic
1018339326 6:162833538-162833560 TTAGTAATTGCCATTCTGACTGG + Intronic
1018806330 6:167264073-167264095 TTAATAACTGCCATTCTAACTGG - Intergenic
1020511871 7:9066661-9066683 TTAATAATTGCCATTCTAACTGG + Intergenic
1020554753 7:9656409-9656431 TTAATGAGTGCCATTCTAACTGG + Intergenic
1020569704 7:9844208-9844230 TTAGTGATTGCCATTCTAACTGG - Intergenic
1020645172 7:10806576-10806598 TTAATGATTGCCCTTCTAACTGG + Intergenic
1021611587 7:22462909-22462931 TTAATGATTGCCCTTCTAACTGG + Intronic
1021671785 7:23042034-23042056 TTAATGAGTGCCATTCTAACTGG - Intergenic
1022869625 7:34462645-34462667 CTAATGATTGCCATTCTAACTGG - Intergenic
1022986246 7:35657321-35657343 TTAGTAATAGCCATTCTAACAGG - Intronic
1023607455 7:41943291-41943313 CTATTAAATGCCCTGCAAACTGG + Intergenic
1023752224 7:43383460-43383482 TTAATAATTGCCATTCTAACTGG + Intronic
1024062560 7:45709827-45709849 CTGGTATGTGCCCTACTTACAGG + Intronic
1024143160 7:46482341-46482363 CTAATGATTGCCATTCTAACTGG - Intergenic
1024426387 7:49230966-49230988 TTAATAATTGCCATTCTAACTGG + Intergenic
1024592828 7:50904174-50904196 TTAATAATTGCCATTCTAACTGG - Intergenic
1024666583 7:51552813-51552835 CTAATGATTGCCATTCTAACTGG + Intergenic
1025194534 7:56922620-56922642 TTGGTAATAGCCCTTCTAACAGG + Intergenic
1025677418 7:63654328-63654350 TTGGTAATAGCCCTTCTAACAGG - Intergenic
1027478757 7:78668070-78668092 TTAGTGATTGCCATTCTAACTGG + Intronic
1027886513 7:83913779-83913801 CTAGTAATAGCCATTCTGACTGG + Intergenic
1028057623 7:86267084-86267106 TTAGTGATTGCCATTCTAACTGG - Intergenic
1028457762 7:91057086-91057108 TTAGTGATTGCCATTCTAACTGG + Intronic
1028518693 7:91705728-91705750 TTAGTAATTGCCATTCTGACTGG - Intronic
1029021256 7:97366907-97366929 TTAGTAATAGCCATTCTAACTGG - Intergenic
1029062772 7:97815797-97815819 TTAATAATTGCCATTCTAACTGG - Intergenic
1029672551 7:102043871-102043893 TTGGTAATAGCCCTTCTAACAGG + Intronic
1031342250 7:120617454-120617476 TTAGTAATAGCCCTTCTGACTGG - Intronic
1031891663 7:127301452-127301474 TTAGTAATAGCCATTCTAACTGG - Intergenic
1032368216 7:131320893-131320915 TTAATAATTGCCATTCTAACTGG - Intronic
1033428425 7:141266287-141266309 TTAGTAACTGCCTTGCTAACTGG + Intronic
1034109006 7:148518053-148518075 TTAGTGATTGCCATTCTAACTGG + Intergenic
1034362242 7:150510268-150510290 GGAGTTAGTGCCCTTATAACAGG + Intergenic
1035135839 7:156702302-156702324 TTAATAATTGCCCTTCTGACTGG + Intronic
1035164207 7:156974801-156974823 TTAGTAATAGCCATTCTAACAGG + Intergenic
1035671317 8:1419676-1419698 CTGGTAACCGCCATTCTAACTGG - Intergenic
1035900207 8:3450992-3451014 CTAATGACTGCCATTCTAACTGG + Intronic
1036050639 8:5192463-5192485 CTAATGATTGCCATTCTAACTGG - Intergenic
1036189186 8:6654760-6654782 TTAGTGATTGCCATTCTAACTGG - Intergenic
1036436677 8:8741205-8741227 TTAATAATTGCCATTCTAACCGG - Intergenic
1036735197 8:11307725-11307747 TTAGTAATAGCCATTCTAACAGG + Intronic
1036925798 8:12904247-12904269 TTAATAATTGCCATTCTAACTGG + Intergenic
1037284916 8:17288897-17288919 TTAATAATTGCCATTCTAACTGG + Intronic
1038439840 8:27564054-27564076 TTAGTAATAGCCGTTCTAACTGG + Intergenic
1038656213 8:29454652-29454674 TTAATAATTGCCATTCTAACTGG - Intergenic
1039672458 8:39617307-39617329 TTAGTAATAGCCATTCTAACTGG - Intronic
1040273166 8:45980713-45980735 TTAATAATTGCCATTCTAACCGG + Intergenic
1040411369 8:47157915-47157937 TTAATAACTGCCATTCTAACTGG - Intergenic
1041751783 8:61268694-61268716 TTAGTGATTGCCATTCTAACTGG + Intronic
1041883609 8:62782233-62782255 TTAGTAATTGGCATTCTAACTGG - Intronic
1041953750 8:63534631-63534653 TTAGTGATTGCCATTCTAACCGG - Intergenic
1042129418 8:65572355-65572377 TTAGTAATAGCCATTCTAACAGG + Intergenic
1043176049 8:77024662-77024684 TTAGTGATTGCCATTCTAACTGG - Intergenic
1043317068 8:78936113-78936135 CTAGTAATAGCCATTCTAACAGG + Intergenic
1043462349 8:80473019-80473041 TTAATAATTGCCATTCTAACTGG + Intergenic
1044632705 8:94294951-94294973 CTAATAATTGCCATTCTAACTGG - Intergenic
1045122261 8:99050711-99050733 TTAATGAGTGCCATTCTAACTGG + Intronic
1045123765 8:99066956-99066978 CTAATGATTGCCATTCTAACTGG - Intronic
1045125258 8:99082139-99082161 TTAATGAGTGCCATTCTAACTGG + Intronic
1046161764 8:110375962-110375984 TTAATAATAGCCCTTCTAACTGG + Intergenic
1046415388 8:113906993-113907015 TTAGTGATTGCCATTCTAACTGG + Intergenic
1046469627 8:114653707-114653729 TTAGTGATTGCCATTCTAACTGG + Intergenic
1047297338 8:123582813-123582835 TTAATAATTGCCATTCTAACTGG - Intergenic
1047674313 8:127183684-127183706 TTAATAATTGCCATTCTAACTGG - Intergenic
1048052217 8:130828792-130828814 TAAGTAAGTACCATTCTAACTGG - Intronic
1048197059 8:132340074-132340096 TTAATAATTGCCATTCTAACTGG - Intronic
1048522292 8:135167957-135167979 TTAGTAAATGTTCTTCTAACTGG + Intergenic
1048629901 8:136231079-136231101 TTAGTAATTGCCATTCTGACTGG + Intergenic
1050359120 9:4811876-4811898 TTAATAATTGCCATTCTAACTGG + Intronic
1050855050 9:10343654-10343676 TTAGTGATTGCCATTCTAACTGG + Intronic
1051005590 9:12339333-12339355 TTAGTGACTGCCATTCTAACTGG - Intergenic
1051223112 9:14871332-14871354 TTAGTGATTGCCATTCTAACTGG + Intronic
1052303985 9:26984770-26984792 TTAGTAACAGCCATTCTAACTGG - Intronic
1052513955 9:29456036-29456058 TTAATAATTGCCATTCTAACTGG - Intergenic
1052802373 9:32981162-32981184 TTAGTAAATGTCCTTCTCACAGG + Intronic
1054317211 9:63606327-63606349 TTAGTAATTGCCATTCTGACTGG - Intergenic
1054819888 9:69511386-69511408 TTAGTGATTGCCATTCTAACTGG - Intronic
1055069584 9:72152467-72152489 CTAATGATTGCCATTCTAACTGG + Intronic
1056302138 9:85252839-85252861 TTAATAATTGCCATTCTAACTGG + Intergenic
1056945668 9:90993876-90993898 TTAATAATTGCCATTCTAACCGG + Intergenic
1058117659 9:101102823-101102845 TTAGTGATTGCCATTCTAACTGG + Intronic
1059372825 9:113856802-113856824 TTAATAATTGCCATTCTAACTGG + Intergenic
1059396971 9:114041008-114041030 TTAATAATTGCCATTCTAACTGG + Intronic
1185695399 X:2190362-2190384 TTAATAATTGCCATTCTAACGGG - Intergenic
1186997943 X:15143674-15143696 CTAGTAAGTCCCCTTTTTATTGG + Intergenic
1187943466 X:24403650-24403672 TTAATAAGTGTCATTCTAACTGG + Intergenic
1188037582 X:25335804-25335826 CTAATAATTGCCATTCTGACTGG + Intergenic
1188074490 X:25758494-25758516 TTAGTTATTGCCATTCTAACTGG + Intergenic
1188151488 X:26681551-26681573 TTAGTAAGAGCCATTCTGACTGG - Intergenic
1188192933 X:27194624-27194646 CTACTAATAGCCATTCTAACTGG + Intergenic
1188770978 X:34154005-34154027 CTAGTAATAGCCATTCTGACCGG + Intergenic
1191227798 X:58063776-58063798 TTAATAATTGCCATTCTAACTGG - Intergenic
1191685162 X:63882286-63882308 TTAATAACTGCCATTCTAACTGG - Intergenic
1191872470 X:65760088-65760110 TTAATAATTGCCATTCTAACTGG + Intergenic
1191956277 X:66645509-66645531 TTAGTGATCGCCCTTCTAACTGG + Intergenic
1192696403 X:73420537-73420559 CTAGTAATAGCCATTCTGACTGG - Intergenic
1192919443 X:75690839-75690861 TTAATAATTGCCATTCTAACTGG + Intergenic
1192945439 X:75961866-75961888 TTAATAATTGCCATTCTAACTGG + Intergenic
1192969296 X:76214633-76214655 TTAATAATTGCCATTCTAACAGG - Intergenic
1192973908 X:76262460-76262482 TTAATAATTGCCATTCTAACTGG + Intergenic
1193091622 X:77500020-77500042 TTAATAACTGCCATTCTAACTGG - Intergenic
1193356577 X:80525945-80525967 TTAGTAATTGCCATTCTGACTGG + Intergenic
1193434715 X:81458737-81458759 GTAGTAATAGCCCTTCTGACTGG + Intergenic
1193495401 X:82204842-82204864 TTAGTAATTGCCATTCTGACTGG + Intergenic
1193647200 X:84083899-84083921 TTAATAATTGCCATTCTAACTGG + Intronic
1193820954 X:86164114-86164136 CTAGTAATAGCCATTCTGACTGG + Intronic
1194095879 X:89637814-89637836 TTAGTGATTGCCATTCTAACTGG + Intergenic
1194304051 X:92220512-92220534 TTAATGATTGCCCTTCTAACTGG - Intronic
1194492187 X:94565615-94565637 TTAGTGATTGCCATTCTAACTGG - Intergenic
1194741407 X:97578848-97578870 TTAATGAGTGCCATTCTAACTGG + Intronic
1194805360 X:98320210-98320232 TTAGTAATTGCCATTCTGACTGG + Intergenic
1194899624 X:99494134-99494156 GTAGTAATAGCCATTCTAACTGG + Intergenic
1194918449 X:99733564-99733586 TTAATAATTGCCATTCTAACTGG + Intergenic
1194986811 X:100499316-100499338 TTAGTAATAGCCATTCTAACTGG - Intergenic
1195528328 X:105920794-105920816 TTAGTGATTGCCATTCTAACTGG - Intronic
1195809390 X:108813329-108813351 TTAATAAGTGCCATTCTGACTGG + Intergenic
1195810158 X:108819912-108819934 TTAATAATTGCCATTCTAACTGG + Intergenic
1195843707 X:109203346-109203368 TTAATAATTGCCATTCTAACTGG + Intergenic
1195846362 X:109233388-109233410 TTAGTGATTGCCATTCTAACTGG - Intergenic
1196172712 X:112607688-112607710 CTAATGATTGCCATTCTAACTGG - Intergenic
1196562668 X:117169289-117169311 CTAATGATTGCCATTCTAACTGG - Intergenic
1196604005 X:117634937-117634959 TTAATAAGTGCCCTTTTAACTGG - Intergenic
1197115542 X:122828507-122828529 TTAATAATTGCCCTTCTGACTGG - Intergenic
1197180283 X:123528047-123528069 GTAATAAGAGCCATTCTAACAGG + Intergenic
1197285288 X:124588003-124588025 TTAGTGATTGCCATTCTAACTGG - Intronic
1197298670 X:124752169-124752191 TTAGTGATTGCCATTCTAACTGG + Intronic
1197566978 X:128100109-128100131 TTAATAATTGCCATTCTAACTGG + Intergenic
1197613803 X:128669713-128669735 TTAGTGATTGCCATTCTAACTGG + Intergenic
1197814006 X:130477985-130478007 TTAGTGATTGCCATTCTAACTGG - Intergenic
1198484704 X:137075401-137075423 TTAGTGATTGCCATTCTAACTGG + Intergenic
1198943727 X:141986499-141986521 TTAATAATTGCCATTCTAACTGG + Intergenic
1199131546 X:144194963-144194985 TTAGTGATTGCCATTCTAACTGG + Intergenic
1199260317 X:145765896-145765918 CTGGTAAAAGCCATTCTAACAGG - Intergenic
1200448880 Y:3299186-3299208 TTAGTGATTGCCATTCTAACTGG + Intergenic
1200596096 Y:5142224-5142246 TTAGTGATTGCCATTCTAACTGG - Intronic
1200771585 Y:7130495-7130517 TTAGTGATTGCCATTCTAACTGG + Intergenic
1200948842 Y:8872186-8872208 CTAATGATTGCCATTCTAACTGG + Intergenic
1201309077 Y:12578235-12578257 TTAGTAATTGCCATTCTAACTGG + Intergenic
1201394283 Y:13531526-13531548 TTAATGAGTGCCATTCTAACTGG + Intergenic
1201708319 Y:16961280-16961302 TTAGTGATTGCCATTCTAACTGG - Intergenic
1201954647 Y:19609319-19609341 TTAATAATTGCCATTCTAACTGG + Intergenic
1201957471 Y:19641511-19641533 TTAGTGATTGCCATTCTAACTGG + Intergenic